MBD5-methyl-CpG binding domain protein 5 Gene View larger

MBD5-methyl-CpG binding domain protein 5 Gene

PTXBC014534

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MBD5-methyl-CpG binding domain protein 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MBD5-methyl-CpG binding domain protein 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014534
Product type: DNA & cDNA
Ncbi symbol: MBD5
Origin species: Human
Product name: MBD5-methyl-CpG binding domain protein 5 Gene
Size: 2ug
Accessions: BC014534
Gene id: 55777
Gene description: methyl-CpG binding domain protein 5
Synonyms: methyl-CpG-binding protein MBD5; MRD1; methyl-CpG-binding domain protein 5; methyl-CpG binding domain protein 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttccctcctactgccaacatgcttctcccaacaggtgaagggcaaagtggtcgagcagcactaagagataagctgatgtctcagcaaaaagacgcattgcggaaaagaaaacaaccacctacgacagtgttgagtttgctcagacagtctcaaatggatagttctgcagttcctaaacctggacctgacttgctaaggaagcagggtcagggttcatttcccatcagttcaatgtctcagttactacagtctatgagttgtcaaagctctcacttgagtagcaatagtaccccgggttgtggggcctcaaatactgctttgccttgctctgctaaccagctgcattttacagatcccagtatgaactctagtgttcttcagaacatacctttaagaggggaagccgtgcactgccacaatgcaaacactaactttgttcacagtaacagtccagtccccaaccaccatcttgcaggtttaataaatcagattcaggctagcgggaactgtgggatgctcagtcagtcgggcatggctttaggaaattccttacatcccaatccacctcagtcaagaatttcaacgtcctccactccagtgataccaaacagcattgttagcagctataatcaaacaagttctgaagcaggtatggttttattagaaaaaagtacccaaaggtactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosphoglycerate mutase 2 (muscle)
- gap junction protein, beta 6, 30kDa
- tetratricopeptide repeat domain 26
- cyclin B1 interacting protein 1

Buy MBD5-methyl-CpG binding domain protein 5 Gene now

Add to cart