CCNB1IP1-cyclin B1 interacting protein 1 Gene View larger

CCNB1IP1-cyclin B1 interacting protein 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCNB1IP1-cyclin B1 interacting protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CCNB1IP1-cyclin B1 interacting protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000369
Product type: DNA & cDNA
Ncbi symbol: CCNB1IP1
Origin species: Human
Product name: CCNB1IP1-cyclin B1 interacting protein 1 Gene
Size: 2ug
Accessions: BC000369
Gene id: 57820
Gene description: cyclin B1 interacting protein 1
Synonyms: E3 ubiquitin-protein ligase CCNB1IP1; C14orf18; cyclin B1 interacting protein 1, E3 ubiquitin protein ligase; human enhancer of invasion 10; cyclin B1 interacting protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctttgtgtgaagacatgctgctttgtaattatcgaaagtgtcgcatcaaactctctggctatgcatgggtcactgcctgctctcacatcttctgtgatcagcatggcagtggtgagtttagtcgctcaccagctatctgtcctgcctgcaacagtaccctttctggaaagctagatattgtccgcacagaactcagtccatcagaggaatataaagctatggtattggcaggactgcgaccagagatcgtgttggacattagctcccgagcgctggccttctggacatatcaggtacatcaggaacgtctctatcaagaatacaatttcagcaaggctgagggccatctgaaacagatggagaagatatatactcagcaaatacaaagcaaggatgtagaattgacctctatgaaaggggaggttacctccatgaagaaagtactagaagaatacaagaaaaagttcagtgacatctctgagaaacttatggagcgcaatcgtcagtatcaaaagctccaaggcctctatgatagccttaggctacgaaacatcactattgctaaccatgaaggcacccttgaaccatccatgattgcacagtctggtgttcttggcttcccattaggtaacaactccaagtttcctttggataatacacctgttcgaaatcggggcgatggagatggagattttcagttcagaccattttttgcgggttctcccacagcacctgaacccagcaacagcttttttagttttgtctctccaagtcgtgaattagagcagcagcaagtttctagcagggccttcaaagtaaaaagaatttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glycine-N-acyltransferase-like 2
- mitochondrial ribosomal protein L2
- polyhomeotic homolog 2 (Drosophila)
- polyhomeotic homolog 2 (Drosophila)

Buy CCNB1IP1-cyclin B1 interacting protein 1 Gene now

Add to cart