GJB6-gap junction protein, beta 6, 30kDa Gene View larger

GJB6-gap junction protein, beta 6, 30kDa Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GJB6-gap junction protein, beta 6, 30kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GJB6-gap junction protein, beta 6, 30kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC038934
Product type: DNA & cDNA
Ncbi symbol: GJB6
Origin species: Human
Product name: GJB6-gap junction protein, beta 6, 30kDa Gene
Size: 2ug
Accessions: BC038934
Gene id: 10804
Gene description: gap junction protein, beta 6, 30kDa
Synonyms: CX30; DFNA3; DFNA3B; DFNB1B; ECTD2; ED2; EDH; HED; HED2; gap junction beta-6 protein; connexin 30; ectodermal dysplasia 2, hidrotic (Clouston syndrome); gap junction protein, beta 6, 30kDa; gap junction protein beta 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggattgggggacgctgcacactttcatcgggggtgtcaacaaacactccaccagcatcgggaaggtgtggatcacagtcatctttattttccgagtcatgatcctcgtggtggctgcccaggaagtgtggggtgacgagcaagaggacttcgtctgcaacacactgcaaccgggatgcaaaaatgtgtgctatgaccactttttcccggtgtcccacatccggctgtgggccctccagctgatcttcgtctccaccccagcgctgctggtggccatgcatgtggcctactacaggcacgaaaccactcgcaagttcaggcgaggagagaagaggaatgatttcaaagacatagaggacattaaaaagcagaaggttcggatagaggggtcgctgtggtggacgtacaccagcagcatctttttccgaatcatctttgaagcagcctttatgtatgtgttttacttcctttacaatgggtaccacctgccctgggtgttgaaatgtgggattgacccctgccccaaccttgttgactgctttatttctaggccaacagagaagaccgtgtttaccatttttatgatttctgcgtctgtgatttgcatgctgcttaacgtggcagagttgtgctacctgctgctgaaagtgtgttttaggagatcaaagagagcacagacgcaaaaaaatcaccccaatcatgccctaaaggagagtaagcagaatgaaatgaatgagctgatttcagatagtggtcaaaatgcaatcacaggtttcccaagctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tetratricopeptide repeat domain 26
- cyclin B1 interacting protein 1
- glycine-N-acyltransferase-like 2
- mitochondrial ribosomal protein L2

Buy GJB6-gap junction protein, beta 6, 30kDa Gene now

Add to cart