Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of GJB6-gap junction protein, beta 6, 30kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GJB6-gap junction protein, beta 6, 30kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC038934 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GJB6 |
| Origin species: | Human |
| Product name: | GJB6-gap junction protein, beta 6, 30kDa Gene |
| Size: | 2ug |
| Accessions: | BC038934 |
| Gene id: | 10804 |
| Gene description: | gap junction protein, beta 6, 30kDa |
| Synonyms: | CX30; DFNA3; DFNA3B; DFNB1B; ECTD2; ED2; EDH; HED; HED2; gap junction beta-6 protein; connexin 30; ectodermal dysplasia 2, hidrotic (Clouston syndrome); gap junction protein, beta 6, 30kDa; gap junction protein beta 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggattgggggacgctgcacactttcatcgggggtgtcaacaaacactccaccagcatcgggaaggtgtggatcacagtcatctttattttccgagtcatgatcctcgtggtggctgcccaggaagtgtggggtgacgagcaagaggacttcgtctgcaacacactgcaaccgggatgcaaaaatgtgtgctatgaccactttttcccggtgtcccacatccggctgtgggccctccagctgatcttcgtctccaccccagcgctgctggtggccatgcatgtggcctactacaggcacgaaaccactcgcaagttcaggcgaggagagaagaggaatgatttcaaagacatagaggacattaaaaagcagaaggttcggatagaggggtcgctgtggtggacgtacaccagcagcatctttttccgaatcatctttgaagcagcctttatgtatgtgttttacttcctttacaatgggtaccacctgccctgggtgttgaaatgtgggattgacccctgccccaaccttgttgactgctttatttctaggccaacagagaagaccgtgtttaccatttttatgatttctgcgtctgtgatttgcatgctgcttaacgtggcagagttgtgctacctgctgctgaaagtgtgttttaggagatcaaagagagcacagacgcaaaaaaatcaccccaatcatgccctaaaggagagtaagcagaatgaaatgaatgagctgatttcagatagtggtcaaaatgcaatcacaggtttcccaagctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tetratricopeptide repeat domain 26 - cyclin B1 interacting protein 1 - glycine-N-acyltransferase-like 2 - mitochondrial ribosomal protein L2 |