TTC26-tetratricopeptide repeat domain 26 Gene View larger

TTC26-tetratricopeptide repeat domain 26 Gene

PTXBC013912

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TTC26-tetratricopeptide repeat domain 26 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TTC26-tetratricopeptide repeat domain 26 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013912
Product type: DNA & cDNA
Ncbi symbol: TTC26
Origin species: Human
Product name: TTC26-tetratricopeptide repeat domain 26 Gene
Size: 2ug
Accessions: BC013912
Gene id: 79989
Gene description: tetratricopeptide repeat domain 26
Synonyms: DYF13; IFT56; dyf-13; intraflagellar transport protein 56; TPR repeat protein 26; tetratricopeptide repeat protein 26; tetratricopeptide repeat domain 26
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgctttcaagggccaaacctgctgtaggcagaggcgtacagcacactgacaaaagaaagaagaaaggtaggaagattccaaaactagaggagctactttcaaaaagagatttcactggagctattaccctgttggagttcaaacgtcatgttggggaagaagaagaggatactaatttgtggattggatattgtgcctttcacctgggtgactacaagagagctctggaggaatacgaaaatgctacaaaagaggaaaattgtaattctgaagtctgggtgaacctagcttgcacctacttctttcttgggatgtataaacaagctgaagcagctggatttaaagcttcaaaaagccgactccaaaaccgcctcctcttccacttggctcacaagtttaatgatgagaaaaaattgatgagctttcatcaaaatcttcaggatgtcacagaagatcaactcagtttggcctcaatccactatatgcgatctcactaccaagaagctatagatatatataagcgaatactgctagataacagggaataccttgcccttaatgtttatgtggccctctgctactacaagttggattactatgatgtgtctcaagaagttttggctgtttaccttcagcaaattcctgatagtaccatcgcactcaatcttaaagcctgtaaccattttcgcctttacaatggcagagcagctgaggcagaactcaaaagcttgatggacaatgcttcttcatcctttgaatttgctaaagaactcatcaggcacaatctggtgaataacgatttcccgtcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cyclin B1 interacting protein 1
- glycine-N-acyltransferase-like 2
- mitochondrial ribosomal protein L2
- polyhomeotic homolog 2 (Drosophila)

Buy TTC26-tetratricopeptide repeat domain 26 Gene now

Add to cart