PGAM2-phosphoglycerate mutase 2 (muscle) Gene View larger

PGAM2-phosphoglycerate mutase 2 (muscle) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PGAM2-phosphoglycerate mutase 2 (muscle) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PGAM2-phosphoglycerate mutase 2 (muscle) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001904
Product type: DNA & cDNA
Ncbi symbol: PGAM2
Origin species: Human
Product name: PGAM2-phosphoglycerate mutase 2 (muscle) Gene
Size: 2ug
Accessions: BC001904
Gene id: 5224
Gene description: phosphoglycerate mutase 2 (muscle)
Synonyms: GSD10; PGAM-M; PGAMM; phosphoglycerate mutase 2; BPG-dependent PGAM 2; muscle-specific phosphoglycerate mutase; phosphoglycerate mutase 2 (muscle); phosphoglycerate mutase isozyme M
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccactcaccgcctcgtgatggtccggcacggcgagagcacatggaaccaggagaaccgtttctgtggctggttcgatgcagagctgagtgaaaaggggaccgaggaggccaagcggggagccaaggccatcaaggatgccaagatggagtttgacatctgctacacgtcagtgctgaagcgggccatccgcaccctctgggccatcctggacggcacggaccagatgtggctgcctgtggtgcgcacttggcgcctcaatgagcggcattacgggggcctcacaggcctcaacaaggcagaaacggccgccaagcacggggaggagcaggtgaagatctggaggcgctccttcgacatcccgccgcccccgatggacgagaagcacccctactacaactccattagcaaggagcgtcggtacgcaggcctgaagcccggggaactccccacctgcgagagcctcaaggacaccattgcccgggccctgcccttctggaacgaggagattgttccccagatcaaggccggcaagcgagtgctcattgcagcccacgggaacagcctgcggggcattgtcaagcacctggaagggatgtcagaccaggcgatcatggagctgaacctgcccacggggatccccattgtgtatgagctgaacaaggagctgaagcccaccaagcccatgcagttcctgggtgatgaggaaacggtgcggaaggccatggaggctgtggctgcccagggcaaggccaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - gap junction protein, beta 6, 30kDa
- tetratricopeptide repeat domain 26
- cyclin B1 interacting protein 1
- glycine-N-acyltransferase-like 2

Buy PGAM2-phosphoglycerate mutase 2 (muscle) Gene now

Add to cart