Login to display prices
Login to display prices
PGAM2-phosphoglycerate mutase 2 (muscle) Gene View larger

PGAM2-phosphoglycerate mutase 2 (muscle) Gene

PTXBC001904

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PGAM2-phosphoglycerate mutase 2 (muscle) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PGAM2-phosphoglycerate mutase 2 (muscle) Gene

Proteogenix catalog: PTXBC001904
Ncbi symbol: PGAM2
Product name: PGAM2-phosphoglycerate mutase 2 (muscle) Gene
Size: 2ug
Accessions: BC001904
Gene id: 5224
Gene description: phosphoglycerate mutase 2 (muscle)
Synonyms: GSD10; PGAM-M; PGAMM; phosphoglycerate mutase 2; BPG-dependent PGAM 2; muscle-specific phosphoglycerate mutase; phosphoglycerate mutase 2 (muscle); phosphoglycerate mutase isozyme M
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccactcaccgcctcgtgatggtccggcacggcgagagcacatggaaccaggagaaccgtttctgtggctggttcgatgcagagctgagtgaaaaggggaccgaggaggccaagcggggagccaaggccatcaaggatgccaagatggagtttgacatctgctacacgtcagtgctgaagcgggccatccgcaccctctgggccatcctggacggcacggaccagatgtggctgcctgtggtgcgcacttggcgcctcaatgagcggcattacgggggcctcacaggcctcaacaaggcagaaacggccgccaagcacggggaggagcaggtgaagatctggaggcgctccttcgacatcccgccgcccccgatggacgagaagcacccctactacaactccattagcaaggagcgtcggtacgcaggcctgaagcccggggaactccccacctgcgagagcctcaaggacaccattgcccgggccctgcccttctggaacgaggagattgttccccagatcaaggccggcaagcgagtgctcattgcagcccacgggaacagcctgcggggcattgtcaagcacctggaagggatgtcagaccaggcgatcatggagctgaacctgcccacggggatccccattgtgtatgagctgaacaaggagctgaagcccaccaagcccatgcagttcctgggtgatgaggaaacggtgcggaaggccatggaggctgtggctgcccagggcaaggccaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: