GSTK1-glutathione S-transferase kappa 1 Gene View larger

GSTK1-glutathione S-transferase kappa 1 Gene

PTXBC001231

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GSTK1-glutathione S-transferase kappa 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GSTK1-glutathione S-transferase kappa 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001231
Product type: DNA & cDNA
Ncbi symbol: GSTK1
Origin species: Human
Product name: GSTK1-glutathione S-transferase kappa 1 Gene
Size: 2ug
Accessions: BC001231
Gene id: 373156
Gene description: glutathione S-transferase kappa 1
Synonyms: GSTK1-1; GST; GST 13-13; GST13; GST13-13; hGSTK1; glutathione S-transferase kappa 1; GST class-kappa; glutathione S-transferase k1; glutathione S-transferase subunit 13 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggcccctgccgcgcaccgtggagctcttctatgacgtgctgtccccctactcctggctgggcttcgagatcctgtgccggtatcagaatatctggaacatcaacctgcagttgcggcccagcctcataacagggatcatgaaagacagtggaaacaagcctccaggtctgcttccccgcaaaggactatacatggcaaatgacttaaagctcctgagacaccatctccagattcccatccacttccccaaggatttcttgtctgtgatgcttgaaaaaggaagtttgtctgccatgcgtttcctcaccgccgtgaacttggagcatccagagatgctggagaaagcgtcccgggagctgtggatgcgcgtctggtcaaggaatgaagacatcaccgagccgcagagcatcctggcggctgcagagaaggctggtatgtctgcagaacaagcccagggacttctggaaaagatcgcaacgccaaaggtgaagaaccagctcaaggagaccactgaggcagcctgcagatacggagcctttgggctgcccatcaccgtggcccatgtggatggccaaacccacatgttatttggctctgaccggatggagctgctggcgcacctgctgggagagaagtggatgggccctatacctccagccgtgaatgccagactttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glutathione S-transferase omega 1
- Kv channel interacting protein 4
- Der1-like domain family, member 1
- proliferating cell nuclear antigen

Buy GSTK1-glutathione S-transferase kappa 1 Gene now

Add to cart