Login to display prices
Login to display prices
KCNIP4-Kv channel interacting protein 4 Gene View larger

KCNIP4-Kv channel interacting protein 4 Gene

PTXBC032520

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KCNIP4-Kv channel interacting protein 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KCNIP4-Kv channel interacting protein 4 Gene

Proteogenix catalog: PTXBC032520
Ncbi symbol: KCNIP4
Product name: KCNIP4-Kv channel interacting protein 4 Gene
Size: 2ug
Accessions: BC032520
Gene id: 80333
Gene description: Kv channel interacting protein 4
Synonyms: CALP; KCHIP4; Kv channel-interacting protein 4; Kv channel interacting protein 4; a-type potassium channel modulatory protein 4; calsenilin-like protein; potassium channel interacting protein 4; potassium voltage-gated channel interacting protein 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatgtgaggagggtggaaagcatttcggctcagctggaggaggccagctctacaggcggtttcctgtacgctcagaacagcaccaagcgcagcattaaagagcggctcatgaagctcttgccctgctcagctgccaaaacgtcgtctcctgctattcaaaacagcgtggaagatgaactggagatggccaccgtcaggcatcggcccgaagcccttgagcttctggaagcccagagcaaatttaccaagaaagagcttcagatcctttacagaggatttaagaacgaatgccccagtggtgttgttaatgaagaaaccttcaaagagatttactcgcagttctttccacagggagactctacaacatatgcacattttctgttcaatgcatttgatacagaccacaatggagctgtgagtttcgaggatttcatcaaaggtctttccattttgctccgggggacagtacaagaaaaactcaattgggcatttaatctgtatgacataaataaagatggctacatcactaaagaggaaatgcttgatataatgaaagcaatatacgatatgatgggtaaatgtacatatcctgtcctcaaagaagatgctcccagacaacacgttgaaacattttttcagaaaatggacaaaaataaagatggggttgttaccatagatgagttcattgaaagctgccaaaaagatgaaaacataatgcgctccatgcagctctttgaaaatgtgatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: