Login to display prices
Login to display prices
DERL1-Der1-like domain family, member 1 Gene View larger

DERL1-Der1-like domain family, member 1 Gene

PTXBC002457

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DERL1-Der1-like domain family, member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DERL1-Der1-like domain family, member 1 Gene

Proteogenix catalog: PTXBC002457
Ncbi symbol: DERL1
Product name: DERL1-Der1-like domain family, member 1 Gene
Size: 2ug
Accessions: BC002457
Gene id: 79139
Gene description: Der1-like domain family, member 1
Synonyms: DER-1; DER1; derlin-1; DERtrin-1; Der1-like domain family, member 1; degradation in endoplasmic reticulum protein 1; derlin 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcggacatcggagactggttcaggagcatcccggcgatcacgcgctattggttcgccgccaccgtcgccgtgcccttggtcggcaaactcggcctcatcagcccggcctacctcttcctctggcccgaagccttcctttatcgctttcagatttggaggccaatcactgccaccttttatttccctgtgggtccaggaactggatttctttatttggtcaatttatatttcttatatcagtattctacgcgacttgaaacaggagcttttgatgggaggccagcagactatttattcatgctcctctttaactggatttgcatcgtgattactggcttagcaatggatatgcagttgctgatgattcctctgatcatgtcagtactttatgtctgggcccagctgaacagagacatgattgtatcattttggtttggaacacgatttaaggcctgctatttaccctgggttatccttggattcaactatatcatcggaggctcggtaatcaatgagcttattggaaatctggttggacatctttattttttcctaatgttcagatacccaatggacttgggaggaagaaattttctatccacacctcagtttttgtaccgctggctgcccagtaggagaggaggagtatcaggatttggtgtgccccctgctagcatgaggcgagctgctgatcagaatggcggaggcgggagacacaactggggccagggctttcgacttggagaccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: