PCNA-proliferating cell nuclear antigen Gene View larger

PCNA-proliferating cell nuclear antigen Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PCNA-proliferating cell nuclear antigen Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PCNA-proliferating cell nuclear antigen Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000491
Product type: DNA & cDNA
Ncbi symbol: PCNA
Origin species: Human
Product name: PCNA-proliferating cell nuclear antigen Gene
Size: 2ug
Accessions: BC000491
Gene id: 5111
Gene description: proliferating cell nuclear antigen
Synonyms: ATLD2; proliferating cell nuclear antigen; DNA polymerase delta auxiliary protein; cyclin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttcgaggcgcgcctggtccagggctccatcctcaagaaggtgttggaggcactcaaggacctcatcaacgaggcctgctgggatattagctccagcggtgtaaacctgcagagcatggactcgtcccacgtctctttggtgcagctcaccctgcggtctgagggcttcgacacctaccgctgcgaccgcaacctggccatgggcgtgaacctcaccagtatgtccaaaatactaaaatgcgccggcaatgaagatatcattacactaagggccgaagataacgcggataccttggcgctagtatttgaagcaccaaaccaggagaaagtttcagactatgaaatgaagttgatggatttagatgttgaacaacttggaattccagaacaggagtacagctgtgtagtaaagatgccttctggtgaatttgcacgtatatgccgagatctcagccatattggagatgctgttgtaatttcctgtgcaaaagacggagtgaaattttctgcaagtggagaacttggaaatggaaacattaaattgtcacagacaagtaatgtcgataaagaggaggaagctgttaccatagagatgaatgaaccagttcaactaacttttgcactgaggtacctgaacttctttacaaaagccactccactctcttcaacggtgacactcagtatgtctgcagatgtaccccttgttgtagagtataaaattgcggatatgggacacttaaaatactacttggctcccaagatcgaggatgaagaaggatcttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - abhydrolase domain containing 10
- BMI1 polycomb ring finger oncogene
- coiled-coil domain containing 54
- regenerating islet-derived 1 beta

Buy PCNA-proliferating cell nuclear antigen Gene now

Add to cart