REG1B-regenerating islet-derived 1 beta Gene View larger

REG1B-regenerating islet-derived 1 beta Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of REG1B-regenerating islet-derived 1 beta Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about REG1B-regenerating islet-derived 1 beta Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027895
Product type: DNA & cDNA
Ncbi symbol: REG1B
Origin species: Human
Product name: REG1B-regenerating islet-derived 1 beta Gene
Size: 2ug
Accessions: BC027895
Gene id: 5968
Gene description: regenerating islet-derived 1 beta
Synonyms: PSPS2; REGH; REGI-BETA; REGL; lithostathine-1-beta; PSP-2; REG-1-beta; pancreatic stone protein 2; regenerating islet-derived 1 beta (pancreatic stone protein, pancreatic thread protein); regenerating islet-derived protein 1-beta; regenerating protein I beta; secretory pancreatic stone protein 2; regenerating family member 1 beta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctcagaccaactcgttcttcatgctgatctcctccctgatgttcctgtctctgagccaaggccaggagtcccagacagagctgcctaatccccgaatcagctgcccagaaggcaccaatgcctatcgctcctactgctactactttaatgaagaccctgagacctgggttgatgcagatctctattgccagaacatgaattcaggcaacctggtgtctgtgctcacccaggcggagggtgccttcgtggcctcactgattaaggagagtagcactgatgacagcaatgtctggattggcctccatgacccaaaaaagaaccgccgctggcactggagtagtgggtccctggtctcctacaagtcctgggacactggatccccgagcagtgctaatgctggctactgtgcaagcctgacttcatgctcaggattcaagaaatggaaggatgaatcttgtgagaagaagttctcctttgtttgcaagttcaaaaactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil domain containing 68
- coiled-coil domain containing 67
- PDLIM1 interacting kinase 1 like
- coiled-coil domain containing 97

Buy REG1B-regenerating islet-derived 1 beta Gene now

Add to cart