CCDC97-coiled-coil domain containing 97 Gene View larger

CCDC97-coiled-coil domain containing 97 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCDC97-coiled-coil domain containing 97 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CCDC97-coiled-coil domain containing 97 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011577
Product type: DNA & cDNA
Ncbi symbol: CCDC97
Origin species: Human
Product name: CCDC97-coiled-coil domain containing 97 Gene
Size: 2ug
Accessions: BC011577
Gene id: 90324
Gene description: coiled-coil domain containing 97
Synonyms: coiled-coil domain-containing protein 97; coiled-coil domain containing 97
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggccgtggcgacggcgacggcggcgaaggaacccgataagggctgcatagagcctggacctgggcactggggtgagctgagccggacaccagtcccatctaaaccccaggacaaagtggaagcagctgaggcaacaccagtggccctggacagtgacacctccggggctgaaaatgcagcagtgagtgctatgctgcacgctgtagccgccagccgcctgcctgtttgcagccagcagcagggtgaacccgacttgacagagcatgagaaagtggccatcctggcccagctgtaccacgagaagccactggtgttcctggagcgcttccgcacaggcctccgtgaggagcatctggcctgctttggccacgtgcgtggcgaccaccgtgcagacttctactgtgctgaggtggcccggcagggcactgcccggccccgcaccctgcgtacccgcctgcgtaaccggcgctatgctgccctgcgagagctgatccaagggggcgagtacttcagtgatgagcagatgcggttccgggcccccctgctatatgagcagtacatcgggcagtatctcacccaggaggagctcagtgcccgcaccccaacccaccagccccccaagcccgggtcccccgggagacctgcttgcccgctctccaacttgctgctccagtcctacgaggagcgggagctacagcagcgtctgctccaacagcaggaggaggaggaggcctgcttggaggaagaggaagaggaggaggacagtgacgaggaagaccagaggtcaggcaaggactcggaggcctgggttcccgactcggaggagaggctgatcctgcgagaggagttcaccagccgcatgcaccagcgcttcctagatggcaaggacggggactttgactacagcacagtagacgacaaccccgacttcgacaacctcgacatcgtggcacgggatgaggaggagaggtactttgatgaggaagaacctgaggatgcgcccagcccagagctggatggggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - bone marrow stromal cell antigen 2
- Ewing sarcoma breakpoint region 1
- coiled-coil domain containing 86
- testis-specific serine kinase 1B

Buy CCDC97-coiled-coil domain containing 97 Gene now

Add to cart