Login to display prices
Login to display prices
PDIK1L-PDLIM1 interacting kinase 1 like Gene View larger

PDIK1L-PDLIM1 interacting kinase 1 like Gene

PTXBC028713

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PDIK1L-PDLIM1 interacting kinase 1 like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PDIK1L-PDLIM1 interacting kinase 1 like Gene

Proteogenix catalog: PTXBC028713
Ncbi symbol: PDIK1L
Product name: PDIK1L-PDLIM1 interacting kinase 1 like Gene
Size: 2ug
Accessions: BC028713
Gene id: 149420
Gene description: PDLIM1 interacting kinase 1 like
Synonyms: serine/threonine-protein kinase PDIK1L; CLIK1L; STK35L2; casein kinase; PDLIM1 interacting kinase 1 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgagtagccagccaaagtacgatctaatacgggaggtaggccgaggtagttacggtgttgtgtatgaagcagtcatcagaaagacctctgcacgggtggcagtgaagaaaattcgatgtcacgcacctgaaaatgttgaactagcccttcgtgagttctgggcactaagcagtatcaagagccaacatccaaatgtgattcacttggaggaatgcatcctacaaaaggatgggatggtgcaaaagatgtcccacggctctaattcttccctttatttacagcttgtagaaacttcattaaaaggagaaattgcctttgatcccagaagcgcctattatttgtggtttgtgatggatttttgtgacggaggagatatgaatgagtatctgttgtccaggaaacccaatcgtaaaactaacaccagcttcatgcttcagctgagcagtgccctggctttcttgcataaaaaccagatcatccaccgagatcttaagcctgataacatcctgatttctcaaaccaggttggataccagtgacttggaacctaccctcaaggtggctgattttggtctaagtaaagtttgttcagcctctgggcagaacccagaagaacctgtcagtgtaaacaagtgtttcctttccacagcatgtggaacagatttttacatggctcctgaagtttgggaaggacattacacagcaaaagctgacatctttgctctggggattatcatctgggcaatgctggaaaggatcacattcatagacacagagacaaagaaggaactcttggggagttatgtaaaacaaggaactgagattgtgcctgttggggaggcacttctggaaaatcccaaaatggaacttctcattcctgtgaagaaaaaatctatgaatgggcgaatgaaacaactgattaaggaaatgctggctgcaaaccctcaggatcgtccagatgcttttgaactagaactcagattagtacaaattgcatttaaagatagcagctgggaaacgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: