PDIK1L-PDLIM1 interacting kinase 1 like Gene View larger

PDIK1L-PDLIM1 interacting kinase 1 like Gene

PTXBC028713

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PDIK1L-PDLIM1 interacting kinase 1 like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PDIK1L-PDLIM1 interacting kinase 1 like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028713
Product type: DNA & cDNA
Ncbi symbol: PDIK1L
Origin species: Human
Product name: PDIK1L-PDLIM1 interacting kinase 1 like Gene
Size: 2ug
Accessions: BC028713
Gene id: 149420
Gene description: PDLIM1 interacting kinase 1 like
Synonyms: serine/threonine-protein kinase PDIK1L; CLIK1L; STK35L2; casein kinase; PDLIM1 interacting kinase 1 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgagtagccagccaaagtacgatctaatacgggaggtaggccgaggtagttacggtgttgtgtatgaagcagtcatcagaaagacctctgcacgggtggcagtgaagaaaattcgatgtcacgcacctgaaaatgttgaactagcccttcgtgagttctgggcactaagcagtatcaagagccaacatccaaatgtgattcacttggaggaatgcatcctacaaaaggatgggatggtgcaaaagatgtcccacggctctaattcttccctttatttacagcttgtagaaacttcattaaaaggagaaattgcctttgatcccagaagcgcctattatttgtggtttgtgatggatttttgtgacggaggagatatgaatgagtatctgttgtccaggaaacccaatcgtaaaactaacaccagcttcatgcttcagctgagcagtgccctggctttcttgcataaaaaccagatcatccaccgagatcttaagcctgataacatcctgatttctcaaaccaggttggataccagtgacttggaacctaccctcaaggtggctgattttggtctaagtaaagtttgttcagcctctgggcagaacccagaagaacctgtcagtgtaaacaagtgtttcctttccacagcatgtggaacagatttttacatggctcctgaagtttgggaaggacattacacagcaaaagctgacatctttgctctggggattatcatctgggcaatgctggaaaggatcacattcatagacacagagacaaagaaggaactcttggggagttatgtaaaacaaggaactgagattgtgcctgttggggaggcacttctggaaaatcccaaaatggaacttctcattcctgtgaagaaaaaatctatgaatgggcgaatgaaacaactgattaaggaaatgctggctgcaaaccctcaggatcgtccagatgcttttgaactagaactcagattagtacaaattgcatttaaagatagcagctgggaaacgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil domain containing 97
- bone marrow stromal cell antigen 2
- Ewing sarcoma breakpoint region 1
- coiled-coil domain containing 86

Buy PDIK1L-PDLIM1 interacting kinase 1 like Gene now

Add to cart