CCDC68-coiled-coil domain containing 68 Gene View larger

CCDC68-coiled-coil domain containing 68 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCDC68-coiled-coil domain containing 68 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CCDC68-coiled-coil domain containing 68 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029508
Product type: DNA & cDNA
Ncbi symbol: CCDC68
Origin species: Human
Product name: CCDC68-coiled-coil domain containing 68 Gene
Size: 2ug
Accessions: BC029508
Gene id: 80323
Gene description: coiled-coil domain containing 68
Synonyms: SE57-1; coiled-coil domain-containing protein 68; CTCL tumor antigen se57-1; CTCL-associated antigen se57-1; cutaneous T-cell lymphoma associated antigen; cutaneous T-cell lymphoma-associated antigen se57-1; coiled-coil domain containing 68
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacaacagtgacagtgaccacagaaattcccccaagggataagatggaagataattctgccttgtatgagtctacgtccgctcacattattgaagaaaccgagtatgtgaaaaagattcgaactactctgcaaaagatcaggacccagatgtttaaagatgaaataagacatgacagtacaaatcacaaactagatgcaaagcactgtggaaaccttcaacagggctctgattctgaaatggatccttcttgttgcagtttggatttgcttatgaaaaagataaaaggaaaagacctacagctcttagaaatgaacaaagagaatgaagtattgaaaatcaaactgcaagcctccagagaagcaggagcagcagctctgagaaacgtggcccagagattatttgaaaactaccaaacgcaatctgaagaagtgagaaagaagcaggaggacagtaaacaattactccaggttaacaagcttgaaaaagaacagaaattgaaacaacatgttgaaaatctgaatcaagttgctgaaaaacttgaagaaaaacacagtcaaattacagaattggagaaccttgtacagagaatggaaaaggaaaagagaacactactagaaagaaaactgtctttggaaaacaagctactgcaactcaaatccagtgctacatatggaaaaagttgccaggatcttcagagggagatttccattctccaggagcagatctctcatctgcagtttgtgattcactcccaacatcagaacctgcgcagtgtcatccaggagatggaaggattaaaaaataatttaaaagaacaagacaaaagaattgaaaatctcagagaaaaggttaacatacttgaagcccagaataaagaactaaaaacccaggtagcactttcatctgaaactcctaggacaaaggtatctaaggctgtctctacaagtgaattgaagaccgaaggtgtttccccttatttaatgttgattaggttacggaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil domain containing 67
- PDLIM1 interacting kinase 1 like
- coiled-coil domain containing 97
- bone marrow stromal cell antigen 2

Buy CCDC68-coiled-coil domain containing 68 Gene now

Add to cart