Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of BMI1-BMI1 polycomb ring finger oncogene Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BMI1-BMI1 polycomb ring finger oncogene Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011652 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BMI1 |
| Origin species: | Human |
| Product name: | BMI1-BMI1 polycomb ring finger oncogene Gene |
| Size: | 2ug |
| Accessions: | BC011652 |
| Gene id: | 648 |
| Gene description: | BMI1 polycomb ring finger oncogene |
| Synonyms: | BMI1 proto-oncogene, polycomb ring finger; polycomb group protein Bmi1; BMI1 polycomb ring finger proto-oncogene; BMI1 polycomb ring finger oncogene; FLVI2/BMI1; PCGF4; RNF51; flvi-2/bmi-1; polycomb complex protein BMI-1; B lymphoma Mo-MLV insertion region 1 homolog; murine leukemia viral (bmi-1) oncogene homolog; polycomb group RING finger protein 4; ring finger protein 51 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcatcgaacaacgagaatcaagatcactgagctaaatccccacctgatgtgtgtgctttgtggagggtacttcattgatgccacaaccataatagaatgtctacattccttctgtaaaacgtgtattgttcgttacctggagaccagcaagtattgtcctatttgtgatgtccaagttcacaagaccagaccactactgaatataaggtcagataaaactctccaagatattgtatacaaattagttccagggcttttcaaaaatgaaatgaagagaagaagggatttttatgcagctcatccttctgctgatgctgccaatggctctaatgaagatagaggagaggttgcagatgaagataagagaattataactgatgatgagataataagcttatccattgaattctttgaccagaacagattggatcggaaagtaaacaaagacaaagagaaatctaaggaggaggtgaatgataaaagatacttacgatgcccagcagcaatgactgtgatgcacttaagaaagtttctcagaagtaaaatggacatacctaatactttccagattgatgtcatgtatgaggaggaacctttaaaggattattatacactaatggatattgcctacatttatacctggagaaggaatggtccacttccattgaaatacagagttcgacctacttgtaaaagaatgaagatcagtcaccagagagatggactgacaaatgctggagaactggaaagtgactctgggagtgacaaggccaacagcccagcaggaggtattccctccacctcttcttgtttgcctagccccagtactccagtgcagtctcctcatccacagtttcctcacatttccagtactatgaatggaaccagcaacagccccagcggtaaccaccaatcttcttttgccaatagacctcgaaaatcatcagtaaatgggtcatcagcaacttcttctggttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - coiled-coil domain containing 54 - regenerating islet-derived 1 beta - coiled-coil domain containing 68 - coiled-coil domain containing 67 |