GSTO1-glutathione S-transferase omega 1 Gene View larger

GSTO1-glutathione S-transferase omega 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GSTO1-glutathione S-transferase omega 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GSTO1-glutathione S-transferase omega 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000127
Product type: DNA & cDNA
Ncbi symbol: GSTO1
Origin species: Human
Product name: GSTO1-glutathione S-transferase omega 1 Gene
Size: 2ug
Accessions: BC000127
Gene id: 9446
Gene description: glutathione S-transferase omega 1
Synonyms: GSTO 1-1; GSTTLp28; HEL-S-21; P28; SPG-R; glutathione S-transferase omega-1; MMA(V) reductase; S-(Phenacyl)glutathione reductase; epididymis secretory protein Li 21; glutathione S-transferase omega 1-1; glutathione-S-transferase like; glutathione-dependent dehydroascorbate reductase; monomethylarsonic acid reductase; glutathione S-transferase omega 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccggggagtcagccaggagcttggggaagggaagcgcgcccccggggccggtcccggagggctcgatccgcatctacagcatgaggttctgcccgtttgctgagaggacgcgtctagtcctgaaggccaagggaatcaggcatgaagtcatcaatatcaacctgaaaaataagcctgagtggttctttaagaaaaatccctttggtctggtgccagttctggaaaacagtcagggtcagctgatctacgagtctgccatcacctgtgagtacctggatgaagcatacccagggaagaagctgttgccggatgacccctatgagaaagcttgccagaagatgatcttagagttgttttctaaggtgccatccttggtaggaagctttattagaagccaaaataaagaagactatgctggcctaaaagaagaatttcgtaaagaatttaccaagctagaggaggttctgactaataagaagacgaccttctttggtggcaattctatctctatgattgattacctcatctggccctggtttgaacggctggaagcaatgaagttaaatgagtgtgtagaccacactccaaaactgaaactgtggatggcagccatgaaggaagatcccacagtctcagccctgcttactagtgagaaagactggcaaggtttcctagagctctacttacagaacagccctgaggcctgtgactatgggctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Kv channel interacting protein 4
- Der1-like domain family, member 1
- proliferating cell nuclear antigen
- abhydrolase domain containing 10

Buy GSTO1-glutathione S-transferase omega 1 Gene now

Add to cart