Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of GSTO1-glutathione S-transferase omega 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GSTO1-glutathione S-transferase omega 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000127 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GSTO1 |
| Origin species: | Human |
| Product name: | GSTO1-glutathione S-transferase omega 1 Gene |
| Size: | 2ug |
| Accessions: | BC000127 |
| Gene id: | 9446 |
| Gene description: | glutathione S-transferase omega 1 |
| Synonyms: | GSTO 1-1; GSTTLp28; HEL-S-21; P28; SPG-R; glutathione S-transferase omega-1; MMA(V) reductase; S-(Phenacyl)glutathione reductase; epididymis secretory protein Li 21; glutathione S-transferase omega 1-1; glutathione-S-transferase like; glutathione-dependent dehydroascorbate reductase; monomethylarsonic acid reductase; glutathione S-transferase omega 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccggggagtcagccaggagcttggggaagggaagcgcgcccccggggccggtcccggagggctcgatccgcatctacagcatgaggttctgcccgtttgctgagaggacgcgtctagtcctgaaggccaagggaatcaggcatgaagtcatcaatatcaacctgaaaaataagcctgagtggttctttaagaaaaatccctttggtctggtgccagttctggaaaacagtcagggtcagctgatctacgagtctgccatcacctgtgagtacctggatgaagcatacccagggaagaagctgttgccggatgacccctatgagaaagcttgccagaagatgatcttagagttgttttctaaggtgccatccttggtaggaagctttattagaagccaaaataaagaagactatgctggcctaaaagaagaatttcgtaaagaatttaccaagctagaggaggttctgactaataagaagacgaccttctttggtggcaattctatctctatgattgattacctcatctggccctggtttgaacggctggaagcaatgaagttaaatgagtgtgtagaccacactccaaaactgaaactgtggatggcagccatgaaggaagatcccacagtctcagccctgcttactagtgagaaagactggcaaggtttcctagagctctacttacagaacagccctgaggcctgtgactatgggctctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Kv channel interacting protein 4 - Der1-like domain family, member 1 - proliferating cell nuclear antigen - abhydrolase domain containing 10 |