Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of SNRPB2-small nuclear ribonucleoprotein polypeptide B'' Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SNRPB2-small nuclear ribonucleoprotein polypeptide B'' Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018022 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SNRPB2 |
| Origin species: | Human |
| Product name: | SNRPB2-small nuclear ribonucleoprotein polypeptide B'' Gene |
| Size: | 2ug |
| Accessions: | BC018022 |
| Gene id: | 6629 |
| Gene description: | small nuclear ribonucleoprotein polypeptide B'' |
| Synonyms: | Msl1; U2B''; U2 small nuclear ribonucleoprotein B''; U2 snRNP B''; small nuclear ribonucleoprotein polypeptide B; small nuclear ribonucleoprotein polypeptide B2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatatcagaccaaatcatacaatttatatcaacaatatgaatgacaaaattaaaaaggaagaattgaagagatccctatatgccctgttttctcagtttggtcatgtggtggacattgtggctttaaagaccatgaagatgagggggcaggcctttgtcatatttaaggaactgggctcatccacaaatgccttgagacagctacaaggatttccattttatggtaaaccaatgcgaatacagtatgcaaaaacagattcggatataatatcaaaaatgcgtggaacttttgctgacaaagaaaagaaaaaagaaaagaaaaaagccaaaactgtggaacagactgcaacaaccacaaacaaaaagcctggccagggaactccaaattcagctaatacccaaggaaattcaacaccaaatcctcaggtccctgattaccctccaaactatattttattccttaataacttaccagaagagactaatgagatgatgttatccatgctgtttaatcagttccctggcttcaaggaagtacgtctggtaccagggaggcatgacattgcttttgttgaatttgaaaatgatgggcaggctggagctgccagggatgctttacagggatttaagatcacaccgtcccatgctatgaagatcacctatgccaagaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - TCF3 (E2A) fusion partner (in childhood Leukemia) - peroxisome proliferator-activated receptor alpha - cell growth regulator with ring finger domain 1 - Ral GEF with PH domain and SH3 binding motif 1 |