Login to display prices
Login to display prices
SNRPB2-small nuclear ribonucleoprotein polypeptide B'' Gene View larger

SNRPB2-small nuclear ribonucleoprotein polypeptide B'' Gene

PTXBC018022

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SNRPB2-small nuclear ribonucleoprotein polypeptide B'' Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SNRPB2-small nuclear ribonucleoprotein polypeptide B'' Gene

Proteogenix catalog: PTXBC018022
Ncbi symbol: SNRPB2
Product name: SNRPB2-small nuclear ribonucleoprotein polypeptide B'' Gene
Size: 2ug
Accessions: BC018022
Gene id: 6629
Gene description: small nuclear ribonucleoprotein polypeptide B''
Synonyms: Msl1; U2B''; U2 small nuclear ribonucleoprotein B''; U2 snRNP B''; small nuclear ribonucleoprotein polypeptide B; small nuclear ribonucleoprotein polypeptide B2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatatcagaccaaatcatacaatttatatcaacaatatgaatgacaaaattaaaaaggaagaattgaagagatccctatatgccctgttttctcagtttggtcatgtggtggacattgtggctttaaagaccatgaagatgagggggcaggcctttgtcatatttaaggaactgggctcatccacaaatgccttgagacagctacaaggatttccattttatggtaaaccaatgcgaatacagtatgcaaaaacagattcggatataatatcaaaaatgcgtggaacttttgctgacaaagaaaagaaaaaagaaaagaaaaaagccaaaactgtggaacagactgcaacaaccacaaacaaaaagcctggccagggaactccaaattcagctaatacccaaggaaattcaacaccaaatcctcaggtccctgattaccctccaaactatattttattccttaataacttaccagaagagactaatgagatgatgttatccatgctgtttaatcagttccctggcttcaaggaagtacgtctggtaccagggaggcatgacattgcttttgttgaatttgaaaatgatgggcaggctggagctgccagggatgctttacagggatttaagatcacaccgtcccatgctatgaagatcacctatgccaagaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: