Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PPARA-peroxisome proliferator-activated receptor alpha Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPARA-peroxisome proliferator-activated receptor alpha Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000052 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPARA |
| Origin species: | Human |
| Product name: | PPARA-peroxisome proliferator-activated receptor alpha Gene |
| Size: | 2ug |
| Accessions: | BC000052 |
| Gene id: | 5465 |
| Gene description: | peroxisome proliferator-activated receptor alpha |
| Synonyms: | NR1C1; PPARalpha; hPPAR; peroxisome proliferator-activated receptor alpha; PPAR-alpha; nuclear receptor subfamily 1 group C member 1; peroxisome proliferative activated receptor, alpha; peroxisome proliferator-activated nuclear receptor alpha variant 3; peroxisome proliferator activated receptor alpha |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtggacacggaaagcccactctgccccctctccccactcgaggccggcgatctagagagcccgttatctgaagagttcctgcaagaaatgggaaacatccaagagatttcgcaatccatcggcgaggatagttctggaagctttggctttacggaataccagtatttaggaagctgtcctggctcagatggctcggtcatcacggacacgctttcaccagcttcgagcccctcctcggtgacttatcctgtggtccccggcagcgtggacgagtctcccagtggagcattgaacatcgaatgtagaatctgcggggacaaggcctcaggctatcattacggagtccacgcgtgtgaaggctgcaagggcttctttcggcgaacgattcgactcaagctggtgtatgacaagtgcgaccgcagctgcaagatccagaaaaagaacagaaacaaatgccagtattgtcgatttcacaagtgcctttctgtcgggatgtcacacaacgcgattcgttttggacgaatgccaagatctgagaaagcaaaactgaaagcagaaattcttacctgtgaacatgacatagaagattctgaaactgcagatctcaaatctctggccaagagaatctacgaggcctacttgaagaacttcaacatgaacaaggtcaaagcccgggtcatcctctcaggaaaggccagtaacaatccagtaggtgtttgcggctgttctgggttctcttggcaacatggaaccagtgtcgtagaggacgattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cell growth regulator with ring finger domain 1 - Ral GEF with PH domain and SH3 binding motif 1 - isocitrate dehydrogenase 2 (NADP+), mitochondrial - ubiquinol-cytochrome c reductase core protein I |