Login to display prices
Login to display prices
RALGPS1-Ral GEF with PH domain and SH3 binding motif 1 Gene View larger

RALGPS1-Ral GEF with PH domain and SH3 binding motif 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RALGPS1-Ral GEF with PH domain and SH3 binding motif 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RALGPS1-Ral GEF with PH domain and SH3 binding motif 1 Gene

Proteogenix catalog: PTXBC033708
Ncbi symbol: RALGPS1
Product name: RALGPS1-Ral GEF with PH domain and SH3 binding motif 1 Gene
Size: 2ug
Accessions: BC033708
Gene id: 9649
Gene description: Ral GEF with PH domain and SH3 binding motif 1
Synonyms: ralA exchange factor RalGPS1; ras-specific guanine nucleotide-releasing factor RalGPS1; RALGEF2; RALGPS1A; Ral guanine nucleotide exchange factor RalGPS1A; RalGEF 2; ral GEF with PH domain and SH3-binding motif 1; ral guanine nucleotide exchange factor 2; Ral GEF with PH domain and SH3 binding motif 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtacaagaggaatggtctgatggctagcgtgttggtcacctctgccactccacagggcagcagcagctcggactctctggagggccagagctgcgactatgccagcaagagctatgatgccgttgtcttcgatgttttgaaagtgaccccagaggagtttgctagccagattacattaatggatatacctgtgtttaaagctatccagccggaggaactagccagctgtggatggagtaagaaggagaaacacagtcttgcccctaacgttgtggcctttacccggaggtttaaccaggtcagtttttgggttgtacgagaaattctaacagcacagactttaaaaataagggcagaaatcctcagccattttgtgaaaatagccaagaaacttctagaactcaacaaccttcattctctcatgtctgtggtatcagcattacaaagtgctcccatcttcaggctgacaaaaacctgggctcttttaaatcgaaaagacaagactacctttgagaaattggactacctgatgtcgaaagaagataattacaagcggacacgggaatatatccgaagcttgaagatggttccaagtattccctatctaggaatctatcttctggatttaatctacattgattctgcatatcctgcctcaggcagtatcatggaaaatgaacaaagatccaatcagatgaacaatattcttcgaataattgctgatttacaagtttcctgcagctatgatcacctcaccaccctgccccatgtgcagaagtacctgaagtccgtacgctacattgaagagctccagaagtttgtggaagacgacaactacaaactgtcgctcagaatcgaaccaggaagcagctctccaagactagtctcttccaaggaagatcttgcagtctcccatctcagcagcctgtcacatcaaggtcaagcagaagaggcaagactcaaacccacctctggccaacaccctgcctggatgtggcccagctcctcacgagtaccagcggctcccccagcatctgctgctccgcgctccccgtggcctaggaatctaagaaatgatcaaggtcaaccaggtgcagtggctctcacctgtaatcccagcactttgggaagccgaagcaggaggatcacttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: