CGRRF1-cell growth regulator with ring finger domain 1 Gene View larger

CGRRF1-cell growth regulator with ring finger domain 1 Gene

PTXBC015063

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CGRRF1-cell growth regulator with ring finger domain 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CGRRF1-cell growth regulator with ring finger domain 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015063
Product type: DNA & cDNA
Ncbi symbol: CGRRF1
Origin species: Human
Product name: CGRRF1-cell growth regulator with ring finger domain 1 Gene
Size: 2ug
Accessions: BC015063
Gene id: 10668
Gene description: cell growth regulator with ring finger domain 1
Synonyms: CGR19; RNF197; cell growth regulator with RING finger domain protein 1; RING finger protein 197; cell growth regulatory gene 19 protein; cell growth regulator with ring finger domain 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcggtgtttctggtaacgctttatgaatactcgccgcttttctacatcgcggtggtctttacctgcttcatcgtgaccaccggcctggtattgggatggtttggttgggatgttccagtaattctgagaaattcagaagagacccagttcagcacaagagttttcaaaaagcaaatgagacaagtcaagaatccttttggcttagagatcactaatccatcttcagcttcaattacaactggcataaccttgacaacagattgccttgaagatagcctccttacatgctactgggggtgcaatgttcaaaaattatatgaagctctgcagaagcatgtttattgcttcagaataagcactccccaagcattagaagatgctctgtatagtgaatatctctatcaggaacagtattttattaaaaaggatagcaaagaagaaatatattgccagttaccaagagatactaaaattgaagactttggtacagtacccagatctcgctatccattggtagcgctattgaccttagctgatgaggatgaccgggaaatttatgatattatttccatggtgtcagtgattcatattcctgataggacttataaactatcctgcagaatattgtatcaatatttactcttggctcaaggtcaatttcatgatcttaagcaacttttcatgtctgcaaataataatttcactccctccaacaattcctcttcagaagaaaaaaacacagacagaagtttgttggaaaaggtgggactctctgaaagtgaagttgagccatcggaagagaacagcaaggactgtgttgtttgccagaatgggactgtgaactgggtactcttaccatgcagacacacatgcctgtgtgatggctgtgtgaagtattttcagcagtgcccaatgtgcaggcagtttgttcaggaatcttttgcactttgcagtcaaaaagagcaagataaagacaaaccgaagactctttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Ral GEF with PH domain and SH3 binding motif 1
- isocitrate dehydrogenase 2 (NADP+), mitochondrial
- ubiquinol-cytochrome c reductase core protein I
- zeta-chain (TCR) associated protein kinase 70kDa

Buy CGRRF1-cell growth regulator with ring finger domain 1 Gene now

Add to cart