TFPT-TCF3 (E2A) fusion partner (in childhood Leukemia) Gene View larger

TFPT-TCF3 (E2A) fusion partner (in childhood Leukemia) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TFPT-TCF3 (E2A) fusion partner (in childhood Leukemia) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TFPT-TCF3 (E2A) fusion partner (in childhood Leukemia) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004281
Product type: DNA & cDNA
Ncbi symbol: TFPT
Origin species: Human
Product name: TFPT-TCF3 (E2A) fusion partner (in childhood Leukemia) Gene
Size: 2ug
Accessions: BC004281
Gene id: 29844
Gene description: TCF3 (E2A) fusion partner (in childhood Leukemia)
Synonyms: FB1; INO80F; amida; TCF3 fusion partner; INO80 complex subunit F; TCF3 (E2A) fusion partner (in childhood Leukemia); amida, partner of the E2A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaattggagcagagagaagggaccatggcagccgtgggctttgaggagttctcagcgccgccaggctcagagttggcgttgcctcccctatttggtggccacatcctggagagcgagctggagacggaagtggagtttgtgtcaggtggtctgggcggctcagggctccgggagcgagatgaagaggaagaggcagcccggggtcggcggcggcgccagcgggaattaaatcgcagaaagtaccaggcactaggtcggcgctgccgggagatcgagcaggtgaacgagcgggtcctgaacaggctccatcaggtgcagaggataactcggaggctgcagcaggaacggaggttcctcatgagagtgctggactcctacggggatgactaccgggccagccagttcaccattgtgctggaggatgagggcagccagggcacggatgcccccaccccaggcaatgcggagaatgagcctccagagaaagagacactgtccccgcccagaaggactcctgcacccccagaacccggcagcccagcccccggtgaggggcccagtgggcggaagaggcggcgagtgccacgggatggacgccgagcaggaaatgcgctgactccagagctggccccggtgcagattaaggttgaggaagactttggctttgaagcagatgaggccctggattccagttgggtttctcggggtccagacaaactgctgccctacccgaccctggccagcccagcctctgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - peroxisome proliferator-activated receptor alpha
- cell growth regulator with ring finger domain 1
- Ral GEF with PH domain and SH3 binding motif 1
- isocitrate dehydrogenase 2 (NADP+), mitochondrial

Buy TFPT-TCF3 (E2A) fusion partner (in childhood Leukemia) Gene now

Add to cart