Login to display prices
Login to display prices
TFPT-TCF3 (E2A) fusion partner (in childhood Leukemia) Gene View larger

TFPT-TCF3 (E2A) fusion partner (in childhood Leukemia) Gene

PTXBC004281

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TFPT-TCF3 (E2A) fusion partner (in childhood Leukemia) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TFPT-TCF3 (E2A) fusion partner (in childhood Leukemia) Gene

Proteogenix catalog: PTXBC004281
Ncbi symbol: TFPT
Product name: TFPT-TCF3 (E2A) fusion partner (in childhood Leukemia) Gene
Size: 2ug
Accessions: BC004281
Gene id: 29844
Gene description: TCF3 (E2A) fusion partner (in childhood Leukemia)
Synonyms: FB1; INO80F; amida; TCF3 fusion partner; INO80 complex subunit F; TCF3 (E2A) fusion partner (in childhood Leukemia); amida, partner of the E2A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaattggagcagagagaagggaccatggcagccgtgggctttgaggagttctcagcgccgccaggctcagagttggcgttgcctcccctatttggtggccacatcctggagagcgagctggagacggaagtggagtttgtgtcaggtggtctgggcggctcagggctccgggagcgagatgaagaggaagaggcagcccggggtcggcggcggcgccagcgggaattaaatcgcagaaagtaccaggcactaggtcggcgctgccgggagatcgagcaggtgaacgagcgggtcctgaacaggctccatcaggtgcagaggataactcggaggctgcagcaggaacggaggttcctcatgagagtgctggactcctacggggatgactaccgggccagccagttcaccattgtgctggaggatgagggcagccagggcacggatgcccccaccccaggcaatgcggagaatgagcctccagagaaagagacactgtccccgcccagaaggactcctgcacccccagaacccggcagcccagcccccggtgaggggcccagtgggcggaagaggcggcgagtgccacgggatggacgccgagcaggaaatgcgctgactccagagctggccccggtgcagattaaggttgaggaagactttggctttgaagcagatgaggccctggattccagttgggtttctcggggtccagacaaactgctgccctacccgaccctggccagcccagcctctgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice