Login to display prices
Login to display prices
TMEM147-transmembrane protein 147 Gene View larger

TMEM147-transmembrane protein 147 Gene

PTXBC001118

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM147-transmembrane protein 147 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM147-transmembrane protein 147 Gene

Proteogenix catalog: PTXBC001118
Ncbi symbol: TMEM147
Product name: TMEM147-transmembrane protein 147 Gene
Size: 2ug
Accessions: BC001118
Gene id: 10430
Gene description: transmembrane protein 147
Synonyms: NIFIE14; transmembrane protein 147; protein NIFIE 14; seven transmembrane domain protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccctgtttcacttcgggaactgcttcgctcttgcctacttcccctacttcatcacctacaagtgcagcggcctgtccgagtacaacgccttctggaaatgcgtccaggctggagtcacctacctctttgtccaactctgcaagatgctgttcttggccactttctttcccacctgggaaggcggcatctatgacttcattggggagttcatgaaggccagcgtggatgtggcagacctgataggtctaaaccttgtcatgtcccggaatgccggcaagggagagtacaagatcatggttgctgccctgggctgggccactgctgagcttattatgtcccgctgcattcccctatgggtcggagcccggggcattgagtttgactggaagtacatccagatgagcatagactccaacatcagtctggtccattacatcgtcgcgtctgctcaggtctggatgataacacgctatgatctgtaccacaccttccggccagctgtcctcctgctgatgttcctcagtgtctacaaggcctttgttatggagaccttcgtccacctctgctcgctgggcagttgggcagctctactggcccgagcagtggtaacggggctgctggccctcagcactttggccctgtatgtcgccgttgtcaatgtgcactcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: