TMEM147-transmembrane protein 147 Gene View larger

TMEM147-transmembrane protein 147 Gene

PTXBC001118

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM147-transmembrane protein 147 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM147-transmembrane protein 147 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001118
Product type: DNA & cDNA
Ncbi symbol: TMEM147
Origin species: Human
Product name: TMEM147-transmembrane protein 147 Gene
Size: 2ug
Accessions: BC001118
Gene id: 10430
Gene description: transmembrane protein 147
Synonyms: NIFIE14; transmembrane protein 147; protein NIFIE 14; seven transmembrane domain protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccctgtttcacttcgggaactgcttcgctcttgcctacttcccctacttcatcacctacaagtgcagcggcctgtccgagtacaacgccttctggaaatgcgtccaggctggagtcacctacctctttgtccaactctgcaagatgctgttcttggccactttctttcccacctgggaaggcggcatctatgacttcattggggagttcatgaaggccagcgtggatgtggcagacctgataggtctaaaccttgtcatgtcccggaatgccggcaagggagagtacaagatcatggttgctgccctgggctgggccactgctgagcttattatgtcccgctgcattcccctatgggtcggagcccggggcattgagtttgactggaagtacatccagatgagcatagactccaacatcagtctggtccattacatcgtcgcgtctgctcaggtctggatgataacacgctatgatctgtaccacaccttccggccagctgtcctcctgctgatgttcctcagtgtctacaaggcctttgttatggagaccttcgtccacctctgctcgctgggcagttgggcagctctactggcccgagcagtggtaacggggctgctggccctcagcactttggccctgtatgtcgccgttgtcaatgtgcactcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - neuronal growth regulator 1
- MACRO domain containing 1
- spindlin family, member 2B
- ARV1 homolog (S. cerevisiae)

Buy TMEM147-transmembrane protein 147 Gene now

Add to cart