ARV1-ARV1 homolog (S. cerevisiae) Gene View larger

ARV1-ARV1 homolog (S. cerevisiae) Gene

PTXBC016309

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ARV1-ARV1 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ARV1-ARV1 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016309
Product type: DNA & cDNA
Ncbi symbol: ARV1
Origin species: Human
Product name: ARV1-ARV1 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC016309
Gene id: 64801
Gene description: ARV1 homolog (S. cerevisiae)
Synonyms: ARV1 homolog, fatty acid homeostasis modulator; protein ARV1; EIEE38
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcaacggcgggcggagcggcctgcagcaggggaaggggaacgtggatggggtggcagcgactcctactgctgcctcggcctcctgccagtacaggtgcatcgaatgcaaccaggaggccaaagagttgtaccgagactataaccacggtgtgctgaagataaccatctgtaaatcctgccagaaacctgtagacaaatatatcgagtatgatcctgttatcatcttgattaatgctatattgtgcaaagctcaggcctacagacatattcttttcaatactcaaataaatatccatggaaaactctgcatattttgtttgctttgtgaagcatacctgaggtggtggcagcttcaagattccaaccagaatactgcccctgatgacttgatcagatatgctaaggaatgggatttctatagaatgtttgcgattgctgctttagaacaaactgcctattttattggcatttttaccttcctgtgggtagaacggcccatgacggcaaaaaaaaagcccaacttcattttgctgctgaaagcattattattatctagctacggaaaactcttgctgattccagctgtcatttgggaacatgactacacatctgtgtgcctcaaactcattaaagtatttgttcttacatcaaattttcaggcaattagagtgaccctaaacatcaaccgtaagctctccttcttggccgtgttgagtggcttactgctggaaagcatcatggtctacttcttccagagtatggaatgggatgttggaagtgattatgccatctttaaatctcaggacttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ATPase, class VI, type 11B
- fragile histidine triad gene
- collagen, type IX, alpha 1
- THUMP domain containing 1

Buy ARV1-ARV1 homolog (S. cerevisiae) Gene now

Add to cart