Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of FHIT-fragile histidine triad gene Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FHIT-fragile histidine triad gene Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032336 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FHIT |
| Origin species: | Human |
| Product name: | FHIT-fragile histidine triad gene Gene |
| Size: | 2ug |
| Accessions: | BC032336 |
| Gene id: | 2272 |
| Gene description: | fragile histidine triad gene |
| Synonyms: | AP3Aase; FRA3B; bis(5'-adenosyl)-triphosphatase; AP3A hydrolase; diadenosine 5',5'''-P1,P3-triphosphate hydrolase; dinucleosidetriphosphatase; fragile histidine triad |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgttcagatttggccaacatctcatcaagccctctgtagtgtttctcaaaacagaactgtccttcgctcttgtgaataggaaacctgtggtaccaggacatgtccttgtgtgcccgctgcggccagtggagcgcttccatgacctgcgtcctgatgaagtggccgatttgtttcagacgacccagagagtcgggacagtggtggaaaaacatttccatgggacctctctcaccttttccatgcaggatggccccgaagccggacagactgtgaagcacgttcacgtccatgttcttcccaggaaggctggagactttcacaggaatgacagcatctatgaggagctccagaaacatgacaaggaggactttcctgcctcttggagatcagaggaggaaatggcagcagaagccgcagctctgcgggtctactttcagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - collagen, type IX, alpha 1 - THUMP domain containing 1 - testes-specific protease 50 - bone morphogenetic protein 4 |