Login to display prices
Login to display prices
FHIT-fragile histidine triad gene Gene View larger

FHIT-fragile histidine triad gene Gene

PTXBC032336

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FHIT-fragile histidine triad gene Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FHIT-fragile histidine triad gene Gene

Proteogenix catalog: PTXBC032336
Ncbi symbol: FHIT
Product name: FHIT-fragile histidine triad gene Gene
Size: 2ug
Accessions: BC032336
Gene id: 2272
Gene description: fragile histidine triad gene
Synonyms: AP3Aase; FRA3B; bis(5'-adenosyl)-triphosphatase; AP3A hydrolase; diadenosine 5',5'''-P1,P3-triphosphate hydrolase; dinucleosidetriphosphatase; fragile histidine triad
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgttcagatttggccaacatctcatcaagccctctgtagtgtttctcaaaacagaactgtccttcgctcttgtgaataggaaacctgtggtaccaggacatgtccttgtgtgcccgctgcggccagtggagcgcttccatgacctgcgtcctgatgaagtggccgatttgtttcagacgacccagagagtcgggacagtggtggaaaaacatttccatgggacctctctcaccttttccatgcaggatggccccgaagccggacagactgtgaagcacgttcacgtccatgttcttcccaggaaggctggagactttcacaggaatgacagcatctatgaggagctccagaaacatgacaaggaggactttcctgcctcttggagatcagaggaggaaatggcagcagaagccgcagctctgcgggtctactttcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: