Login to display prices
Login to display prices
COL9A1-collagen, type IX, alpha 1 Gene View larger

COL9A1-collagen, type IX, alpha 1 Gene

PTXBC015409

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of COL9A1-collagen, type IX, alpha 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about COL9A1-collagen, type IX, alpha 1 Gene

Proteogenix catalog: PTXBC015409
Ncbi symbol: COL9A1
Product name: COL9A1-collagen, type IX, alpha 1 Gene
Size: 2ug
Accessions: BC015409
Gene id: 1297
Gene description: collagen, type IX, alpha 1
Synonyms: DJ149L1.1.2; EDM6; MED; STL4; collagen alpha-1(IX) chain; alpha-1(IX) collagen chain; cartilage-specific short collagen; collagen IX, alpha-1 polypeptide; collagen, type IX, alpha 1; collagen type IX alpha 1 chain
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagacctgctggaaaattccagttttcttctttgtgtgcagtttcctggaaccctgggcatctgcagctgtcaagcgtcgccccagattccctgtcaattccaattctaatggtggaaatgaactctgtccaaagatcaggattggccaagatgacttaccagggtttgatctgatctctcagttccaggtagataaagcagcatctagaagagctatccagagagtagtgggatcagctacattgcaggtggcttacaagttgggaaataatgtagacttcaggattccaactaggaatttatatcccagtggactgcctgaagaatactccttcttgacgacgtttcgaatgactggaagcactctcaaaaagaactggaacatttggcagattcaggattcctctgggaaggagcaagttggcataaagattaatggccaaacacaatctgttgtattttcatacaagggactggatggaagtctccaaacagcagccttttcgaatttgtcctccttgtttgattcccagtggcataagatcatgattggcgtggagaggagtagtgctactctttttgttgactgcaacaggattgaatctttacctataaagccaagaggcccaattgacattgatggctttgctgtgctgggaaaacttgcagataatcctcaagtttctgttccatttgaacttcaatggatgctgatccattgtgaccccctgcggcccaggagagaaacttgccatgagctgccagccagaataacgcccagccagaccaccgacgagagaggtcccccgggtgagcagggtcctcccgggcctccgggcccccctggagttccaggcatcgatggcatcgacggtgaccgaggtcctaagggccccccgggccccccgggtcctgcaggtgaaccgggaaagccaggagctccaggcaagcctggcacacctggcgctgataccagtccttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: