COL9A1-collagen, type IX, alpha 1 Gene View larger

COL9A1-collagen, type IX, alpha 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of COL9A1-collagen, type IX, alpha 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about COL9A1-collagen, type IX, alpha 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015409
Product type: DNA & cDNA
Ncbi symbol: COL9A1
Origin species: Human
Product name: COL9A1-collagen, type IX, alpha 1 Gene
Size: 2ug
Accessions: BC015409
Gene id: 1297
Gene description: collagen, type IX, alpha 1
Synonyms: DJ149L1.1.2; EDM6; MED; STL4; collagen alpha-1(IX) chain; alpha-1(IX) collagen chain; cartilage-specific short collagen; collagen IX, alpha-1 polypeptide; collagen, type IX, alpha 1; collagen type IX alpha 1 chain
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagacctgctggaaaattccagttttcttctttgtgtgcagtttcctggaaccctgggcatctgcagctgtcaagcgtcgccccagattccctgtcaattccaattctaatggtggaaatgaactctgtccaaagatcaggattggccaagatgacttaccagggtttgatctgatctctcagttccaggtagataaagcagcatctagaagagctatccagagagtagtgggatcagctacattgcaggtggcttacaagttgggaaataatgtagacttcaggattccaactaggaatttatatcccagtggactgcctgaagaatactccttcttgacgacgtttcgaatgactggaagcactctcaaaaagaactggaacatttggcagattcaggattcctctgggaaggagcaagttggcataaagattaatggccaaacacaatctgttgtattttcatacaagggactggatggaagtctccaaacagcagccttttcgaatttgtcctccttgtttgattcccagtggcataagatcatgattggcgtggagaggagtagtgctactctttttgttgactgcaacaggattgaatctttacctataaagccaagaggcccaattgacattgatggctttgctgtgctgggaaaacttgcagataatcctcaagtttctgttccatttgaacttcaatggatgctgatccattgtgaccccctgcggcccaggagagaaacttgccatgagctgccagccagaataacgcccagccagaccaccgacgagagaggtcccccgggtgagcagggtcctcccgggcctccgggcccccctggagttccaggcatcgatggcatcgacggtgaccgaggtcctaagggccccccgggccccccgggtcctgcaggtgaaccgggaaagccaggagctccaggcaagcctggcacacctggcgctgataccagtccttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - THUMP domain containing 1
- testes-specific protease 50
- bone morphogenetic protein 4
- jumonji domain containing 5

Buy COL9A1-collagen, type IX, alpha 1 Gene now

Add to cart