TSP50-testes-specific protease 50 Gene View larger

TSP50-testes-specific protease 50 Gene

PTXBC033016

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TSP50-testes-specific protease 50 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TSP50-testes-specific protease 50 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033016
Product type: DNA & cDNA
Ncbi symbol: TSP50
Origin species: Human
Product name: TSP50-testes-specific protease 50 Gene
Size: 2ug
Accessions: BC033016
Gene id: 29122
Gene description: testes-specific protease 50
Synonyms: TSP50; CT20; cancer/testis antigen 20; serine protease 50; testes-specific protease 50; testicular tissue protein Li 210; testis-specific protease-like protein 50; protease, serine 50
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtcgctggtgccagaccgtcgcgcgcgggcagcgcccccggacgtctgccccctcccgcgccggtgccctgctgctgctgcttctgttgctgaggtctgcaggttgctggggcgcaggggaagccccgggggcgctgtccactgctgatcccgccgaccagagcgtccagtgtgtccccaaggccacctgtccttccagccggcctcgccttctctggcagaccccgaccacccagacactgccctcgaccaccatggagacccaattcccagtttctgaaggcaaagtcgacccataccgctcctgtggcttttcctacgagcaggaccccaccctcagggacccagaagccgtggctcggcggtggccctggatggtcagcgtgcgggccaatggcacacacatctgtgccggcaccatcattgcctcccagtgggtgctgactgtggcccactgcctgatctggcgtgatgttatctactcagtgagggtggggagtccgtggattgaccagatgacgcagaccgcctccgatgtcccggtgctccaggtcatcatgcatagcaggtaccgggcccagcggttctggtcctgggtgggccaggccaacgacatcggcctcctcaagctcaagcaggaactcaagtacagcaattacgtgcggcccatctgcctgcctggcacggactatgtgttgaaggaccattcccgctgcactgtgacgggctggggactttccaaggctgacggcatgtggcctcagttccggaccattcaggagaaggaagtcatcatcctgaacaacaaagagtgtgacaatttctaccacaacttcaccaaaatccccactctggttcagatcatcaagtcccagatgatgtgtgcggaggacacccacagggagaagttctgctatgagctaactggagagcccttggtctgctccatggagggcacgtggtacctggtgggattggtgagctggggtgcaggctgccagaagagcgaggccccacccatctacctacaggtctcctcctaccaacactggatctgggactgcctcaacgggcaggccctggccctgccagccccatccaggaccctgctcctggcactcccactgcccctcagcctccttgctgccctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - bone morphogenetic protein 4
- jumonji domain containing 5
- death inducer-obliterator 1
- THUMP domain containing 3

Buy TSP50-testes-specific protease 50 Gene now

Add to cart