Login to display prices
Login to display prices
NEGR1-neuronal growth regulator 1 Gene View larger

NEGR1-neuronal growth regulator 1 Gene

PTXBC036771

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NEGR1-neuronal growth regulator 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NEGR1-neuronal growth regulator 1 Gene

Proteogenix catalog: PTXBC036771
Ncbi symbol: NEGR1
Product name: NEGR1-neuronal growth regulator 1 Gene
Size: 2ug
Accessions: BC036771
Gene id: 257194
Gene description: neuronal growth regulator 1
Synonyms: DMML2433; IGLON4; KILON; Ntra; neuronal growth regulator 1; IgLON family member 4; a kindred of IgLON; neurotractin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaggtgcatctaactgtgcaagttcctcctaagatatatgacatctcaaatgatatgaccgtcaatgaaggaaccaacgtcactcttacttgtttggccactgggaaaccagagccttccatttcttggcgacacatctccccatcagcaaaaccatttgaaaatggacaatatttggacatttatggaattacaagggaccaggctggggaatatgaatgcagtgcggaaaatgatgtgtcattcccagatgtgaggaaagtaaaagttgttgtcaactttgctcctactattcaggaaattaaatctggcaccgtgacccccggacgcagtggcctgataagatgtgaaggtgcaggtgtgccgcctccagcctttgaatggtacaaaggagagaagaagctcttcaatggccaacaaggaattattattcaaaattttagcacaagatccattctcactgttaccaacgtgacacaggagcacttcggcaattatacttgtgtggctgccaacaagctaggcacaaccaatgcgagcctgcctcttaaccctccaagtacagcccagtatggaattaccgggagcgctgatgttcttttctcctgctggtaccttgtgttgacactgtcctctttcaccagcatattctacctgaagaatgccattctacaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: