NEGR1-neuronal growth regulator 1 Gene View larger

NEGR1-neuronal growth regulator 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NEGR1-neuronal growth regulator 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NEGR1-neuronal growth regulator 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036771
Product type: DNA & cDNA
Ncbi symbol: NEGR1
Origin species: Human
Product name: NEGR1-neuronal growth regulator 1 Gene
Size: 2ug
Accessions: BC036771
Gene id: 257194
Gene description: neuronal growth regulator 1
Synonyms: DMML2433; IGLON4; KILON; Ntra; neuronal growth regulator 1; IgLON family member 4; a kindred of IgLON; neurotractin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaggtgcatctaactgtgcaagttcctcctaagatatatgacatctcaaatgatatgaccgtcaatgaaggaaccaacgtcactcttacttgtttggccactgggaaaccagagccttccatttcttggcgacacatctccccatcagcaaaaccatttgaaaatggacaatatttggacatttatggaattacaagggaccaggctggggaatatgaatgcagtgcggaaaatgatgtgtcattcccagatgtgaggaaagtaaaagttgttgtcaactttgctcctactattcaggaaattaaatctggcaccgtgacccccggacgcagtggcctgataagatgtgaaggtgcaggtgtgccgcctccagcctttgaatggtacaaaggagagaagaagctcttcaatggccaacaaggaattattattcaaaattttagcacaagatccattctcactgttaccaacgtgacacaggagcacttcggcaattatacttgtgtggctgccaacaagctaggcacaaccaatgcgagcctgcctcttaaccctccaagtacagcccagtatggaattaccgggagcgctgatgttcttttctcctgctggtaccttgtgttgacactgtcctctttcaccagcatattctacctgaagaatgccattctacaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - MACRO domain containing 1
- spindlin family, member 2B
- ARV1 homolog (S. cerevisiae)
- ATPase, class VI, type 11B

Buy NEGR1-neuronal growth regulator 1 Gene now

Add to cart