Login to display prices
Login to display prices
MACROD1-MACRO domain containing 1 Gene View larger

MACROD1-MACRO domain containing 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MACROD1-MACRO domain containing 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MACROD1-MACRO domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003188
Product type: DNA & cDNA
Ncbi symbol: MACROD1
Origin species: Human
Product name: MACROD1-MACRO domain containing 1 Gene
Size: 2ug
Accessions: BC003188
Gene id: 28992
Gene description: MACRO domain containing 1
Synonyms: O-acetyl-ADP-ribose deacetylase MACROD1; LRP16; MACRO domain-containing protein 1; [Protein ADP-ribosylglutamate] hydrolase; MACRO domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcgaaggtggacctgagcacctccaccgactggaaggaggcgaaatcctttctgaagggcctgagtgacaagcagcgggaggaacattacttctgcaaggactttgtcaggctgaagaagatcccgacatggaaggagatggcgaaaggggtggctgtgaaggtggaggagcccaggtataaaaaggacaagcagctcaatgagaaaatctccctgctccgcagcgacatcaccaagctggaggtggacgccatcgtcaacgccgccaacagctccctgctcggaggcggtggcgtggacggctgcattcatcgggccgccggccccctgcttaccgacgagtgccggaccctgcagagctgtaagactggcaaggccaagatcaccggcggctatcggctcccggccaagtacgtcatccacacagtggggcccatcgcctacggggagcccagcgccagtcaggctgccgagctccgcagctgctacctgagcagtctggacctgctgctggagcaccggctccgctcggtggcgttcccctgcatctccaccggcgtgtttggctacccctgtgaggcggccgccgagatcgtgctggccacgctgcgagagtggctggagcagcacaaggacaaggtggaccggctgatcatctgcgtgttcctcgagaaggacgaggacatctaccggagccggctcccccactacttccccgtggcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - spindlin family, member 2B
- ARV1 homolog (S. cerevisiae)
- ATPase, class VI, type 11B
- fragile histidine triad gene