Login to display prices
Login to display prices
SPIN2B-spindlin family, member 2B Gene View larger

SPIN2B-spindlin family, member 2B Gene

PTXBC000044

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPIN2B-spindlin family, member 2B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SPIN2B-spindlin family, member 2B Gene

Proteogenix catalog: PTXBC000044
Ncbi symbol: SPIN2B
Product name: SPIN2B-spindlin family, member 2B Gene
Size: 2ug
Accessions: BC000044
Gene id: 474343
Gene description: spindlin family, member 2B
Synonyms: SPIN-2; SPIN-2B; SPIN2_duplicate; TDRD26; dJ323P24.2; spindlin-2B; spindlin family, member 2 duplicate; spindlin-like protein 2B; telomeric SPIN2 copy; spindlin family member 2B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagacccccaacgcacaggaagccgaagggcaacaaaccagggcagctgcaggacgggccactgggtctgcaaacatgacaaagaaaaaagtctcccaaaagaagcagagaggccgaccttcatcccagccccgcaggaacatcgtgggctgcagaatttctcatggatggaaggaaggagatgagcccatcacgcagtggaaaggaaccgttctggatcaggtgcctataaatccctctctttatctggtgaaatatgatggaattgactgtgtctatggactggaacttcacagagatgaaagggttttgtctcttaaaattctttctgacagggtggcatcatctcacattagtgatgccaaccttgcaaataccataattggcaaagcagtggaacatatgtttgagggagagcatggttctaaggatgaatggagggggatggtcttagctcaagcacctatcatgaaagcctggttttatattacctatgagaaagatcctgtcttgtacatgtaccagcttctagatgattataaggaaggtgacctccgcatcatgccagaatccagtgagtctcctccaacagagagggagccaggaggagttgtagatggcctaataggtaagcatgtggaatataccaaagaagatggctccaaaaggatcggcatggtcattcaccaagtggaagccaaaccctctgtgtatttcatcaagtttgatgatgatttccatatctatgtctacgatttggtgaaaaagtcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: