Login to display prices
Login to display prices
GSTA4-glutathione S-transferase alpha 4 Gene View larger

GSTA4-glutathione S-transferase alpha 4 Gene

PTXBC015523

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GSTA4-glutathione S-transferase alpha 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GSTA4-glutathione S-transferase alpha 4 Gene

Proteogenix catalog: PTXBC015523
Ncbi symbol: GSTA4
Product name: GSTA4-glutathione S-transferase alpha 4 Gene
Size: 2ug
Accessions: BC015523
Gene id: 2941
Gene description: glutathione S-transferase alpha 4
Synonyms: GSTA4-4; GTA4; glutathione S-transferase A4; GST class-alpha member 4; S-(hydroxyalkyl)glutathione lyase A4; glutathione S-alkyltransferase A4; glutathione S-aralkyltransferase A4; glutathione S-aryltransferase A4; glutathione S-transferase A4-4; glutathione transferase A4-4; glutathione S-transferase alpha 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagcaaggcccaagctccactatcccaacggaagaggccggatggagtccgtgagatgggttttagctgccgccggagtcgagtttgatgaagaatttctggaaacaaaagaacagttgtacaagttgcaggatggtaaccacctgctgttccaacaagtgcccatggttgaaattgacgggatgaagttggtacagacccgaagcattctccactacatagcagacaagcacaatctctttggcaagaacctcaaggagagaaccctgattgacatgtacgtggaggggacactggatctgctggaactgcttatcatgcatcctttcttaaaaccagatgatcagcaaaaggaagtggttaacatggcccagaaggctataattagatactttcctgtgtttgaaaagattttaaggggtcacggacaaagctttcttgttggtaatcagctgagccttgcagatgtgattttactccaaaccattttagctctagaagagaaaattcctaatatcctgtctgcatttcctttcctccaggaatacacagtgaaactaagtaatatccctacaattaagagattccttgaacctggcagcaagaagaagcctccccctgatgaaatttatgtgagaaccgtctacaacatctttaggccataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: