GSTA4-glutathione S-transferase alpha 4 Gene View larger

GSTA4-glutathione S-transferase alpha 4 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GSTA4-glutathione S-transferase alpha 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GSTA4-glutathione S-transferase alpha 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015523
Product type: DNA & cDNA
Ncbi symbol: GSTA4
Origin species: Human
Product name: GSTA4-glutathione S-transferase alpha 4 Gene
Size: 2ug
Accessions: BC015523
Gene id: 2941
Gene description: glutathione S-transferase alpha 4
Synonyms: GSTA4-4; GTA4; glutathione S-transferase A4; GST class-alpha member 4; S-(hydroxyalkyl)glutathione lyase A4; glutathione S-alkyltransferase A4; glutathione S-aralkyltransferase A4; glutathione S-aryltransferase A4; glutathione S-transferase A4-4; glutathione transferase A4-4; glutathione S-transferase alpha 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagcaaggcccaagctccactatcccaacggaagaggccggatggagtccgtgagatgggttttagctgccgccggagtcgagtttgatgaagaatttctggaaacaaaagaacagttgtacaagttgcaggatggtaaccacctgctgttccaacaagtgcccatggttgaaattgacgggatgaagttggtacagacccgaagcattctccactacatagcagacaagcacaatctctttggcaagaacctcaaggagagaaccctgattgacatgtacgtggaggggacactggatctgctggaactgcttatcatgcatcctttcttaaaaccagatgatcagcaaaaggaagtggttaacatggcccagaaggctataattagatactttcctgtgtttgaaaagattttaaggggtcacggacaaagctttcttgttggtaatcagctgagccttgcagatgtgattttactccaaaccattttagctctagaagagaaaattcctaatatcctgtctgcatttcctttcctccaggaatacacagtgaaactaagtaatatccctacaattaagagattccttgaacctggcagcaagaagaagcctccccctgatgaaatttatgtgagaaccgtctacaacatctttaggccataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glutathione S-transferase kappa 1
- glutathione S-transferase omega 1
- Kv channel interacting protein 4
- Der1-like domain family, member 1

Buy GSTA4-glutathione S-transferase alpha 4 Gene now

Add to cart