FGF19-fibroblast growth factor 19 Gene View larger

FGF19-fibroblast growth factor 19 Gene

PTXBC017664

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FGF19-fibroblast growth factor 19 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FGF19-fibroblast growth factor 19 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017664
Product type: DNA & cDNA
Ncbi symbol: FGF19
Origin species: Human
Product name: FGF19-fibroblast growth factor 19 Gene
Size: 2ug
Accessions: BC017664
Gene id: 9965
Gene description: fibroblast growth factor 19
Synonyms: fibroblast growth factor 19; FGF-19
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcggagcgggtgtgtggtggtccacgtatggatcctggccggcctctggctggccgtggccgggcgccccctcgccttctcggacgcggggccccacgtgcactacggctggggcgaccccatccgcctgcggcacctgtacacctccggcccccacgggctctccagctgcttcctgcgcatccgtgccgacggcgtcgtggactgcgcgcggggccagagcgcgcacagtttgctggagatcaaggcagtcgctctgcggaccgtggccatcaagggcgtgcacagcgtgcggtacctctgcatgggcgccgacggcaagatgcaggggctgcttcagtactcggaggaagactgtgctttcgaggaggagatccgcccagatggctacaatgtgtaccgatccgagaagcaccgcctcccggtctccctgagcagtgccaaacagcggcagctgtacaagaacagaggctttcttccactctctcatttcctgcccatgctgcccatggtcccagaggagcctgaggacctcaggggccacttggaatctgacatgttctcttcgcccctggagaccgacagcatggacccatttgggcttgtcaccggactggaggccgtgaggagtcccagctttgagaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 147
- neuronal growth regulator 1
- MACRO domain containing 1
- spindlin family, member 2B

Buy FGF19-fibroblast growth factor 19 Gene now

Add to cart