Cart 2 Product Products 226,80 € (empty)
-
1 x PRNP-prion...113,40 € -
1 x MRPL13-mit...113,40 €
No products
To be determined Shipping
226,80 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 226,80 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 226,80 €
View larger 
SEC22B-SEC22 vesicle trafficking protein homolog B (S. cerevisiae) Gene
PTXBC001364
New product
Data sheet of SEC22B-SEC22 vesicle trafficking protein homolog B (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SEC22B-SEC22 vesicle trafficking protein homolog B (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001364 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SEC22B |
| Origin species: | Human |
| Product name: | SEC22B-SEC22 vesicle trafficking protein homolog B (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC001364 |
| Gene id: | 9554 |
| Gene description: | SEC22 vesicle trafficking protein homolog B (S. cerevisiae) |
| Synonyms: | vesicle-trafficking protein SEC22b; ERS-24; SEC22L1; ER-Golgi SNARE of 24 kDa; SEC22 vesicle trafficking protein homolog B; SEC22 vesicle trafficking protein-like 1; SEC22 homolog B, vesicle trafficking protein (gene/pseudogene) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgttgctaacaatgatcgcccgagtggcggacgggctcccgctggccgcctcgatgcaggaggacgaacagtctggccgggaccttcaacagtatcagagtcaggctaagcaactctttcgaaagttgaatgaacagtcccctaccagatgtaccttggaagcaggagccatgacttttcactacattattgagcagggggtgtgttatttggttttatgtgaagctgccttccctaagaagttggcttttgcctacctagaagatttgcactcagaatttgatgaacagcatggaaagaaggtgcccactgtgtcccgaccctattcctttattgaatttgatactttcattcagaaaaccaagaagctctacattgacagtcgtgctcgaagaaatctaggctccatcaacactgaattgcaagatgtgcagaggatcatggtggccaatattgaagaagtgttacaacgaggagaagcactctcagcattggattcaaaggctaacaatttgtccagtctgtccaagaaataccgccaggatgcgaagtacttgaacatgcgttccacttatgccaaacttgcagcagtagctgtatttttcatcatgttaatagtgtatgtccgattctggtggctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 - proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 - serpin peptidase inhibitor, clade B (ovalbumin), member 6 - serpin peptidase inhibitor, clade B (ovalbumin), member 9 |