Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SERPINB6-serpin peptidase inhibitor, clade B (ovalbumin), member 6 Gene
PTXBC001394
New product
Data sheet of SERPINB6-serpin peptidase inhibitor, clade B (ovalbumin), member 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SERPINB6-serpin peptidase inhibitor, clade B (ovalbumin), member 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001394 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SERPINB6 |
| Origin species: | Human |
| Product name: | SERPINB6-serpin peptidase inhibitor, clade B (ovalbumin), member 6 Gene |
| Size: | 2ug |
| Accessions: | BC001394 |
| Gene id: | 5269 |
| Gene description: | serpin peptidase inhibitor, clade B (ovalbumin), member 6 |
| Synonyms: | CAP; DFNB91; MSTP057; PI-6; PI6; PTI; SPI3; serpin B6; cytoplasmic antiproteinase; protease inhibitor 6 (placental thrombin inhibitor); serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 6; serpin peptidase inhibitor, clade B (ovalbumin), member 6; serpin family B member 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatgttctcgcagaagcaaatggcacctttgccttaaaccttttgaaaacgctgggtaaagacaactcgaagaatgtgtttttctcacccatgagcatgtcctgtgccctggccatggtctacatgggggcaaagggaaacaccgctgcacagatggcccagatactttctttcaataaaagtggcggtggtggagacatccaccagggcttccagtctcttctcaccgaagtgaacaagactggcacgcagtacttgcttagggtggccaacaggctctttggggaaaagtcttgtgatttcctctcatcttttagagattcctgccaaaaattctaccaagcagagatggaggagcttgactttatcagcgccgtagagaagtccagaaaacacataaacacctgggtagctgaaaagacagaaggtaaaattgcggagttgctctctccgggctcagtggatccattgacaaggctggttctggtgaatgctgtctatttcagaggaaactgggatgaacagtttgacaaggagaacaccgaggagagactgtttaaagtcagcaagaatgaggagaaacctgtgcaaatgatgtttaagcaatctacttttaagaagacctatataggagaaatatttacccaaatcttggtgcttccatatgttggcaaggaactgaatatgatcatcatgcttccggacgagaccactgacttgagaacggtggagaaagaactcacttacgagaagttcgtagaatggacgaggctggacatgatggatgaagaggaggtggaagtgtccctcccgcggtttaaactagaggaaagctacgacatggagagtgtcctgcgcaacctgggcatgactgatgccttcgagctgggcaaggcagacttctctggaatgtcccagacagacctgtctctgtccaaggtcgtgcacaagtcttttgtggaggtcaatgaggaaggcacggaggctgcagccgccacagctgccatcatgatgatgcggtgtgccagattcgtcccccgcttctgcgccgaccaccccttccttttcttcatccagcacagcaagaccaacgggattctcttctgcggccgcttttcctctccgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - serpin peptidase inhibitor, clade B (ovalbumin), member 9 - serpin peptidase inhibitor, clade B (ovalbumin), member 2 - polymerase (DNA directed), delta 2, regulatory subunit 50kDa - SHC (Src homology 2 domain containing) transforming protein 3 |