SERPINB6-serpin peptidase inhibitor, clade B (ovalbumin), member 6 Gene View larger

SERPINB6-serpin peptidase inhibitor, clade B (ovalbumin), member 6 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SERPINB6-serpin peptidase inhibitor, clade B (ovalbumin), member 6 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SERPINB6-serpin peptidase inhibitor, clade B (ovalbumin), member 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001394
Product type: DNA & cDNA
Ncbi symbol: SERPINB6
Origin species: Human
Product name: SERPINB6-serpin peptidase inhibitor, clade B (ovalbumin), member 6 Gene
Size: 2ug
Accessions: BC001394
Gene id: 5269
Gene description: serpin peptidase inhibitor, clade B (ovalbumin), member 6
Synonyms: CAP; DFNB91; MSTP057; PI-6; PI6; PTI; SPI3; serpin B6; cytoplasmic antiproteinase; protease inhibitor 6 (placental thrombin inhibitor); serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 6; serpin peptidase inhibitor, clade B (ovalbumin), member 6; serpin family B member 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatgttctcgcagaagcaaatggcacctttgccttaaaccttttgaaaacgctgggtaaagacaactcgaagaatgtgtttttctcacccatgagcatgtcctgtgccctggccatggtctacatgggggcaaagggaaacaccgctgcacagatggcccagatactttctttcaataaaagtggcggtggtggagacatccaccagggcttccagtctcttctcaccgaagtgaacaagactggcacgcagtacttgcttagggtggccaacaggctctttggggaaaagtcttgtgatttcctctcatcttttagagattcctgccaaaaattctaccaagcagagatggaggagcttgactttatcagcgccgtagagaagtccagaaaacacataaacacctgggtagctgaaaagacagaaggtaaaattgcggagttgctctctccgggctcagtggatccattgacaaggctggttctggtgaatgctgtctatttcagaggaaactgggatgaacagtttgacaaggagaacaccgaggagagactgtttaaagtcagcaagaatgaggagaaacctgtgcaaatgatgtttaagcaatctacttttaagaagacctatataggagaaatatttacccaaatcttggtgcttccatatgttggcaaggaactgaatatgatcatcatgcttccggacgagaccactgacttgagaacggtggagaaagaactcacttacgagaagttcgtagaatggacgaggctggacatgatggatgaagaggaggtggaagtgtccctcccgcggtttaaactagaggaaagctacgacatggagagtgtcctgcgcaacctgggcatgactgatgccttcgagctgggcaaggcagacttctctggaatgtcccagacagacctgtctctgtccaaggtcgtgcacaagtcttttgtggaggtcaatgaggaaggcacggaggctgcagccgccacagctgccatcatgatgatgcggtgtgccagattcgtcccccgcttctgcgccgaccaccccttccttttcttcatccagcacagcaagaccaacgggattctcttctgcggccgcttttcctctccgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - serpin peptidase inhibitor, clade B (ovalbumin), member 9
- serpin peptidase inhibitor, clade B (ovalbumin), member 2
- polymerase (DNA directed), delta 2, regulatory subunit 50kDa
- SHC (Src homology 2 domain containing) transforming protein 3

Buy SERPINB6-serpin peptidase inhibitor, clade B (ovalbumin), member 6 Gene now

Add to cart