Login to display prices
Login to display prices
SERPINB9-serpin peptidase inhibitor, clade B (ovalbumin), member 9 Gene View larger

SERPINB9-serpin peptidase inhibitor, clade B (ovalbumin), member 9 Gene

PTXBC002538

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SERPINB9-serpin peptidase inhibitor, clade B (ovalbumin), member 9 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SERPINB9-serpin peptidase inhibitor, clade B (ovalbumin), member 9 Gene

Proteogenix catalog: PTXBC002538
Ncbi symbol: SERPINB9
Product name: SERPINB9-serpin peptidase inhibitor, clade B (ovalbumin), member 9 Gene
Size: 2ug
Accessions: BC002538
Gene id: 5272
Gene description: serpin peptidase inhibitor, clade B (ovalbumin), member 9
Synonyms: CAP-3; CAP3; PI-9; PI9; serpin B9; cytoplasmic antiproteinase 3; peptidase inhibitor 9; protease inhibitor 9 (ovalbumin type); serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 9; serpin peptidase inhibitor, clade B (ovalbumin), member 9; serpin peptidase inhibitor, clade B, member 9; testicular tissue protein Li 180; serpin family B member 9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaactctttctaatgcaagtggtacttttgccatacgccttttaaagatactgtgtcaagataacccttcgcacaacgtgttctgttctcctgtgagcatctcctctgccctggccatggttctcctaggggcaaagggaaacaccgcaacccagatggcccaggcactgtctttaaacacagaggaagacattcatcgggctttccagtcgcttctcactgaagtgaacaaggctggcacacagtacctgctgagaacggccaacaggctctttggagagaaaacttgtcagttcctctcaacgtttaaggaatcctgtcttcaattctaccatgctgagctgaaggagctttcctttatcagagctgcagaagagtccaggaaacacatcaacacctgggtctcaaaaaagaccgaaggtaaaattgaagagttgttgccgggtagctcaattgatgcagaaaccaggctggttcttgtcaatgccatctacttcaaaggaaagtggaatgaaccgtttgacgaaacatacacaagggaaatgccctttaaaataaaccaggaggagcaaaggccagtgcagatgatgtatcaggaggccacgtttaagctcgcccacgtgggcgaggtgcgcgcgcagctgctggagctgccctacgccaggaaggagctgagcctgctggtgctgctgcctgacgacggcgtggagctcagcacggtggaaaaaagtctcacttttgagaaactcacagcctggaccaagccagactgtatgaagagtactgaggttgaagttctccttccaaaatttaaactacaagaggattatgacatggaatctgtgcttcggcatttgggaattgttgatgccttccaacagggcaaggctgacttgtcggcaatgtcagcggagagagacctgtgtctgtccaagttcgtgcacaagagttttgtggaggtgaatgaagaaggcaccgaggcagcggcagcgtcgagctgctttgtagttgcagagtgctgcatggaatctggccccaggttctgtgctgaccaccctttccttttcttcatcaggcacaacagagccaacagcattctgttctgtggcaggttctcatcgccataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: