Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
POLD2-polymerase (DNA directed), delta 2, regulatory subunit 50kDa Gene
PTXBC000459
New product
Data sheet of POLD2-polymerase (DNA directed), delta 2, regulatory subunit 50kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about POLD2-polymerase (DNA directed), delta 2, regulatory subunit 50kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000459 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | POLD2 |
| Origin species: | Human |
| Product name: | POLD2-polymerase (DNA directed), delta 2, regulatory subunit 50kDa Gene |
| Size: | 2ug |
| Accessions: | BC000459 |
| Gene id: | 5425 |
| Gene description: | polymerase (DNA directed), delta 2, regulatory subunit 50kDa |
| Synonyms: | DNA polymerase delta subunit 2; DAN polymerase delta 2, accessory subunit; DNA polymerase delta subunit p50; Pol delta B subunit (p50); polymerase (DNA directed), delta 2, accessory subunit; polymerase (DNA directed), delta 2, regulatory subunit 50kDa; polymerase (DNA) delta 2, accessory subunit; DNA polymerase delta 2, accessory subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttttctgagcaggctgcccagagggcccacactctactgtccccaccatcagccaacaatgccacctttgcccgggtgccagtggcaacctacaccaactcctcacaacccttccggctaggagagcgcagctttagccggcagtatgcccacatttatgccacccgcctcatccaaatgagacccttcctggagaaccgggcccagcagcactggggcagtggagtgggagtgaagaagctgtgtgaactgcagcctgaggagaagtgctgtgtggtgggcactctgttcaaggccatgccgctgcagccctccatcctgcgggaggtcagcgaggagcacaacctgctcccccagcctcctcggagtaaatacatacacccagatgacgagctggtcttggaagatgaactgcagcgtatcaaactaaaaggcaccattgacgtgtcaaagctggttacggggactgtcctggctgtgtttggctccgtgagagacgacgggaagtttctggtggaggactattgctttgctgaccttgctccccagaagcccgcacccccacttgacacagataggtttgtgctactggtgtccggcctgggcctgggtggcggtggaggcgagagcctgctgggcacccagctgctggtggatgtggtgacggggcagcttggggacgaaggggagcagtgcagcgccgcccacgtctcccgggttatcctcgctggcaacctcctcagccacagcacccagagcagggattctatcaataaggccaaatacctcaccaagaaaacccaggcagccagcgtggaggctgttaagatgctggatgagatcctcctgcagctgagcgcctcagtgcccgtggacgtgatgccaggcgagtttgatcccaccaattacacgctcccccagcagcccctccacccctgcatgttcccgctggccactgcctactccacgctccagctggtcaccaacccctaccaggccaccattgatggagtcagatttttggggacatcaggacagaacgtgagtgacattttccgatacagcagcatggaggatcacttggagatcctggagtggaccctgcgggtccgtcacatcagccccacagcccctgacactctaggttgttaccccttctacaaaactgacccgttcatcttcccagagtgcccgcatgtctacttttgtggcaacacccccagctttggctccaaaatcatccgaggtcctgaggaccagacagtgctgttggtgactgtccctgacttcagtgccacgcagaccgcctgccttgtgaacctgcgcagcctggcctgccagcccatcagcttctcgggcttcggggcagaggacgatgacctgggaggcctggggctgggcccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SHC (Src homology 2 domain containing) transforming protein 3 - LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) - NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa - myosin, light chain 6B, alkali, smooth muscle and non-muscle |