Login to display prices
Login to display prices
POLD2-polymerase (DNA directed), delta 2, regulatory subunit 50kDa Gene View larger

POLD2-polymerase (DNA directed), delta 2, regulatory subunit 50kDa Gene

PTXBC000459

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of POLD2-polymerase (DNA directed), delta 2, regulatory subunit 50kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about POLD2-polymerase (DNA directed), delta 2, regulatory subunit 50kDa Gene

Proteogenix catalog: PTXBC000459
Ncbi symbol: POLD2
Product name: POLD2-polymerase (DNA directed), delta 2, regulatory subunit 50kDa Gene
Size: 2ug
Accessions: BC000459
Gene id: 5425
Gene description: polymerase (DNA directed), delta 2, regulatory subunit 50kDa
Synonyms: DNA polymerase delta subunit 2; DAN polymerase delta 2, accessory subunit; DNA polymerase delta subunit p50; Pol delta B subunit (p50); polymerase (DNA directed), delta 2, accessory subunit; polymerase (DNA directed), delta 2, regulatory subunit 50kDa; polymerase (DNA) delta 2, accessory subunit; DNA polymerase delta 2, accessory subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttttctgagcaggctgcccagagggcccacactctactgtccccaccatcagccaacaatgccacctttgcccgggtgccagtggcaacctacaccaactcctcacaacccttccggctaggagagcgcagctttagccggcagtatgcccacatttatgccacccgcctcatccaaatgagacccttcctggagaaccgggcccagcagcactggggcagtggagtgggagtgaagaagctgtgtgaactgcagcctgaggagaagtgctgtgtggtgggcactctgttcaaggccatgccgctgcagccctccatcctgcgggaggtcagcgaggagcacaacctgctcccccagcctcctcggagtaaatacatacacccagatgacgagctggtcttggaagatgaactgcagcgtatcaaactaaaaggcaccattgacgtgtcaaagctggttacggggactgtcctggctgtgtttggctccgtgagagacgacgggaagtttctggtggaggactattgctttgctgaccttgctccccagaagcccgcacccccacttgacacagataggtttgtgctactggtgtccggcctgggcctgggtggcggtggaggcgagagcctgctgggcacccagctgctggtggatgtggtgacggggcagcttggggacgaaggggagcagtgcagcgccgcccacgtctcccgggttatcctcgctggcaacctcctcagccacagcacccagagcagggattctatcaataaggccaaatacctcaccaagaaaacccaggcagccagcgtggaggctgttaagatgctggatgagatcctcctgcagctgagcgcctcagtgcccgtggacgtgatgccaggcgagtttgatcccaccaattacacgctcccccagcagcccctccacccctgcatgttcccgctggccactgcctactccacgctccagctggtcaccaacccctaccaggccaccattgatggagtcagatttttggggacatcaggacagaacgtgagtgacattttccgatacagcagcatggaggatcacttggagatcctggagtggaccctgcgggtccgtcacatcagccccacagcccctgacactctaggttgttaccccttctacaaaactgacccgttcatcttcccagagtgcccgcatgtctacttttgtggcaacacccccagctttggctccaaaatcatccgaggtcctgaggaccagacagtgctgttggtgactgtccctgacttcagtgccacgcagaccgcctgccttgtgaacctgcgcagcctggcctgccagcccatcagcttctcgggcttcggggcagaggacgatgacctgggaggcctggggctgggcccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: