POLD2-polymerase (DNA directed), delta 2, regulatory subunit 50kDa Gene View larger

POLD2-polymerase (DNA directed), delta 2, regulatory subunit 50kDa Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of POLD2-polymerase (DNA directed), delta 2, regulatory subunit 50kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about POLD2-polymerase (DNA directed), delta 2, regulatory subunit 50kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000459
Product type: DNA & cDNA
Ncbi symbol: POLD2
Origin species: Human
Product name: POLD2-polymerase (DNA directed), delta 2, regulatory subunit 50kDa Gene
Size: 2ug
Accessions: BC000459
Gene id: 5425
Gene description: polymerase (DNA directed), delta 2, regulatory subunit 50kDa
Synonyms: DNA polymerase delta subunit 2; DAN polymerase delta 2, accessory subunit; DNA polymerase delta subunit p50; Pol delta B subunit (p50); polymerase (DNA directed), delta 2, accessory subunit; polymerase (DNA directed), delta 2, regulatory subunit 50kDa; polymerase (DNA) delta 2, accessory subunit; DNA polymerase delta 2, accessory subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttttctgagcaggctgcccagagggcccacactctactgtccccaccatcagccaacaatgccacctttgcccgggtgccagtggcaacctacaccaactcctcacaacccttccggctaggagagcgcagctttagccggcagtatgcccacatttatgccacccgcctcatccaaatgagacccttcctggagaaccgggcccagcagcactggggcagtggagtgggagtgaagaagctgtgtgaactgcagcctgaggagaagtgctgtgtggtgggcactctgttcaaggccatgccgctgcagccctccatcctgcgggaggtcagcgaggagcacaacctgctcccccagcctcctcggagtaaatacatacacccagatgacgagctggtcttggaagatgaactgcagcgtatcaaactaaaaggcaccattgacgtgtcaaagctggttacggggactgtcctggctgtgtttggctccgtgagagacgacgggaagtttctggtggaggactattgctttgctgaccttgctccccagaagcccgcacccccacttgacacagataggtttgtgctactggtgtccggcctgggcctgggtggcggtggaggcgagagcctgctgggcacccagctgctggtggatgtggtgacggggcagcttggggacgaaggggagcagtgcagcgccgcccacgtctcccgggttatcctcgctggcaacctcctcagccacagcacccagagcagggattctatcaataaggccaaatacctcaccaagaaaacccaggcagccagcgtggaggctgttaagatgctggatgagatcctcctgcagctgagcgcctcagtgcccgtggacgtgatgccaggcgagtttgatcccaccaattacacgctcccccagcagcccctccacccctgcatgttcccgctggccactgcctactccacgctccagctggtcaccaacccctaccaggccaccattgatggagtcagatttttggggacatcaggacagaacgtgagtgacattttccgatacagcagcatggaggatcacttggagatcctggagtggaccctgcgggtccgtcacatcagccccacagcccctgacactctaggttgttaccccttctacaaaactgacccgttcatcttcccagagtgcccgcatgtctacttttgtggcaacacccccagctttggctccaaaatcatccgaggtcctgaggaccagacagtgctgttggtgactgtccctgacttcagtgccacgcagaccgcctgccttgtgaacctgcgcagcctggcctgccagcccatcagcttctcgggcttcggggcagaggacgatgacctgggaggcctggggctgggcccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SHC (Src homology 2 domain containing) transforming protein 3
- LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae)
- NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa
- myosin, light chain 6B, alkali, smooth muscle and non-muscle

Buy POLD2-polymerase (DNA directed), delta 2, regulatory subunit 50kDa Gene now

Add to cart