Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PSMD13-proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 Gene
PTXBC001100
New product
Data sheet of PSMD13-proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSMD13-proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001100 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSMD13 |
| Origin species: | Human |
| Product name: | PSMD13-proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 Gene |
| Size: | 2ug |
| Accessions: | BC001100 |
| Gene id: | 5719 |
| Gene description: | proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 |
| Synonyms: | HSPC027; Rpn9; S11; p40.5; 26S proteasome non-ATPase regulatory subunit 13; 26S proteasome regulatory subunit RPN9; 26S proteasome regulatory subunit S11; 26S proteasome regulatory subunit p40.5; 26S proteasome subunit p40.5; proteasome (prosome, macropain) 26S subunit, non-ATPase, 13; proteasome 26S subunit, non-ATPase 13 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaggacgtaccgggcttcctacagcagagccagagctccgggcccgggcagcccgctgtgtggcaccgtctggaggagctctacacgaagaagttgtggcatcagctgacacttcaggtgcttgattttgtgcaggatccgtgctttgcccaaggagatggtctcattaagctttatgaaaactttatcagtgaatttgaacacagggtgaatcctctgtccctcgtggaaatcattcttcacgtagttagacagatgactgatcctaatgtggctcttacttttctggaaaagactcgtgagaaggtgaaaagtagtgatgaggcagtgatcctgtgtaaaacagcaattggagctctaaaattaaacatcggggacctacaggttacaaaggaaacaattgaagatgttgaagaaatgctcaacaaccttcctggtgtgacatcggttcacagtcgtttctatgatctctccagtaaatactatcaaacaatcggaaaccacgcgtcctactacaaagatgctctgcggtttttgggctgtgttgacatcaaggatctaccagtgtctgagcagcaggagagagccttcacgctggggctagcaggacttctcggcgagggagtttttaactttggagaactcctcatgcaccctgtgctggagtccctgaggaatactgaccggcagtggctgattgacaccctctatgccttcaacagtggcaacgtagagcggttccagactctgaagactgcctggggccagcagcctgatttagcagctaatgaagcccagcttctgaggaaaattcagttgttgtgcctcatggagatgactttcacacgacctgccaatcacagacaactcacttttgaagaaattgccaaaagtgctaaaatcacagtgaatgaggtggagcttctggtgatgaaggccctttcggtggggctggtgaaaggcagtatagacgaggtggacaaacgagtccacatgacctgggtgcagccccgagtgttggatttgcaacagatcaagggaatgaaggaccgcctggagttctggtgcacggatgtgaagagcatggagatgctggtggagcaccaggcccatgacatcctcacctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - serpin peptidase inhibitor, clade B (ovalbumin), member 6 - serpin peptidase inhibitor, clade B (ovalbumin), member 9 - serpin peptidase inhibitor, clade B (ovalbumin), member 2 - polymerase (DNA directed), delta 2, regulatory subunit 50kDa |