Login to display prices
Login to display prices
PSMD13-proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 Gene View larger

PSMD13-proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 Gene

PTXBC001100

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSMD13-proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PSMD13-proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 Gene

Proteogenix catalog: PTXBC001100
Ncbi symbol: PSMD13
Product name: PSMD13-proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 Gene
Size: 2ug
Accessions: BC001100
Gene id: 5719
Gene description: proteasome (prosome, macropain) 26S subunit, non-ATPase, 13
Synonyms: HSPC027; Rpn9; S11; p40.5; 26S proteasome non-ATPase regulatory subunit 13; 26S proteasome regulatory subunit RPN9; 26S proteasome regulatory subunit S11; 26S proteasome regulatory subunit p40.5; 26S proteasome subunit p40.5; proteasome (prosome, macropain) 26S subunit, non-ATPase, 13; proteasome 26S subunit, non-ATPase 13
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaggacgtaccgggcttcctacagcagagccagagctccgggcccgggcagcccgctgtgtggcaccgtctggaggagctctacacgaagaagttgtggcatcagctgacacttcaggtgcttgattttgtgcaggatccgtgctttgcccaaggagatggtctcattaagctttatgaaaactttatcagtgaatttgaacacagggtgaatcctctgtccctcgtggaaatcattcttcacgtagttagacagatgactgatcctaatgtggctcttacttttctggaaaagactcgtgagaaggtgaaaagtagtgatgaggcagtgatcctgtgtaaaacagcaattggagctctaaaattaaacatcggggacctacaggttacaaaggaaacaattgaagatgttgaagaaatgctcaacaaccttcctggtgtgacatcggttcacagtcgtttctatgatctctccagtaaatactatcaaacaatcggaaaccacgcgtcctactacaaagatgctctgcggtttttgggctgtgttgacatcaaggatctaccagtgtctgagcagcaggagagagccttcacgctggggctagcaggacttctcggcgagggagtttttaactttggagaactcctcatgcaccctgtgctggagtccctgaggaatactgaccggcagtggctgattgacaccctctatgccttcaacagtggcaacgtagagcggttccagactctgaagactgcctggggccagcagcctgatttagcagctaatgaagcccagcttctgaggaaaattcagttgttgtgcctcatggagatgactttcacacgacctgccaatcacagacaactcacttttgaagaaattgccaaaagtgctaaaatcacagtgaatgaggtggagcttctggtgatgaaggccctttcggtggggctggtgaaaggcagtatagacgaggtggacaaacgagtccacatgacctgggtgcagccccgagtgttggatttgcaacagatcaagggaatgaaggaccgcctggagttctggtgcacggatgtgaagagcatggagatgctggtggagcaccaggcccatgacatcctcacctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: