Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PSMD10-proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 Gene
PTXBC011960
New product
Data sheet of PSMD10-proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSMD10-proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011960 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSMD10 |
| Origin species: | Human |
| Product name: | PSMD10-proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 Gene |
| Size: | 2ug |
| Accessions: | BC011960 |
| Gene id: | 5716 |
| Gene description: | proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 |
| Synonyms: | dJ889N15.2; p28; p28(GANK); 26S proteasome non-ATPase regulatory subunit 10; 26S proteasome regulatory subunit p28; ankyrin repeat protein; hepatocellular carcinoma-associated protein p28-II; proteasome (prosome, macropain) 26S subunit, non-ATPase, 10; proteasome 26S subunit, non-ATPase 10 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggggtgtgtgtctaacctaatggtctgcaacctggcctacagcgggaagctggaagagttgaaggagagtattctggccgataaatccctggctactagaactgaccaggacagcagaactgcattgcactgggcatgctcagctggacatacagaaattgttgaatttttgttgcaacttggagtgccagtgaatgataaagacgatgcaggttggtctcctcttcatattgcggcttctgctggccgggatgagattgtaaaagcccttctgggaaaaggtgctcaagtgaatgctgtcaatcaaaatggctgtactcccttacattatgcagcttcgaaaaacaggcatgagatcgctgtcatgttactggaaggcggggctaatccagatgctaaggaccattatgaggctacagcaatgcaccgggcagcagccaagggtaacttgaagatgattcatatccttctgtactacaaagcatccacaaacatccaagacactgagggtaacactcctctacacttagcctgtgatgaggagagagtggaagaagcaaaactgctggtgtcccaaggagcaagtatttacattgagaataaagaagaaaagacacccctgcaagtggccaaaggtggcctgggtttaatactcaagagaatggtggaaggttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 - serpin peptidase inhibitor, clade B (ovalbumin), member 6 - serpin peptidase inhibitor, clade B (ovalbumin), member 9 - serpin peptidase inhibitor, clade B (ovalbumin), member 2 |