GOSR2-golgi SNAP receptor complex member 2 Gene View larger

GOSR2-golgi SNAP receptor complex member 2 Gene

PTXBC009710

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GOSR2-golgi SNAP receptor complex member 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GOSR2-golgi SNAP receptor complex member 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009710
Product type: DNA & cDNA
Ncbi symbol: GOSR2
Origin species: Human
Product name: GOSR2-golgi SNAP receptor complex member 2 Gene
Size: 2ug
Accessions: BC009710
Gene id: 9570
Gene description: golgi SNAP receptor complex member 2
Synonyms: Bos1; EPM6; GS27; Golgi SNAP receptor complex member 2; 27 kDa Golgi SNARE protein; membrin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatcccctgttccagcaaacgcacaagcaggtccacgagatccagtcttgcatgggacgcctggagacggcagacaagcagtctgtgcacatagtagaaaacgaaatccaagcaagcatagaccagatattcagccgtctagaacgtctggagattttgtccagcaaggagccccctaacaaaaggcaaaatgccagacttcgggttgaccagttaaagtatgatgtccagcacctgcagactgcgctcagaaacttccagcatcggcgccatgcaagggagcagcaggagagacagcgagaagagcttctgtctcgaaccttcaccactaacgactctgacaccaccataccaatggacgaatcactgcagtttaactcctccctccagaaagttcacaacggcatggatgacctcattttagatgggcacaatattttagatggactgaggacccagagactgaccttgaaggggactcagaagaagatccttgacattgccaacatgctgggcttgtccaacacagtgatgcggctcatcgagaagcgggctttccaggacaagtactttatgataggtgggatgctgctgacctgtgtggtcatgttcctcgtggtgcagtacctgacatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial ribosomal protein S35
- mitochondrial ribosomal protein L16
- mitochondrial ribosomal protein L28
- chromosome 12 open reading frame 5

Buy GOSR2-golgi SNAP receptor complex member 2 Gene now

Add to cart