MRPL16-mitochondrial ribosomal protein L16 Gene View larger

MRPL16-mitochondrial ribosomal protein L16 Gene

PTXBC001040

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPL16-mitochondrial ribosomal protein L16 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MRPL16-mitochondrial ribosomal protein L16 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001040
Product type: DNA & cDNA
Ncbi symbol: MRPL16
Origin species: Human
Product name: MRPL16-mitochondrial ribosomal protein L16 Gene
Size: 2ug
Accessions: BC001040
Gene id: 54948
Gene description: mitochondrial ribosomal protein L16
Synonyms: L16mt; MRP-L16; PNAS-111; 39S ribosomal protein L16, mitochondrial; mitochondrial ribosomal protein L16
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggaggctgctggctcgcgctagtgcgccgctcctgcgggtgcccttgtcagattcctgggcactcctccccgccagtgctggcgtaaagacactgctcccagtaccaagttttgaagatgtttccattcctgaaaaacccaagcttagatttattgaaagggcaccacttgtgccaaaagtaagaagagaacctaaaaatttaagtgacatacggggaccttccactgaagctacggagtttacagaaggcaattttgcaatcttggcattgggtggtggctacctgcattggggccactttgaaatgatgcgcctgacaatcaaccgctctatggaccccaagaacatgtttgccatatggcgagtaccagcccctttcaagcccatcactcgcaaaagtgttgggcatcgcatggggggaggcaaaggtgctattgaccactacgtgacacctgtgaaggctggccgccttgttgtagagatgggtgggcgttgtgaatttgaagaagtgcaaggtttccttgaccaggttgcccacaagttgcccttcgcagcaaaggctgtgagccgcgggactctagagaagatgcgaaaagatcaagaggaaagagaacgtaacaaccagaacccctggacatttgagcgaatagccactgccaacatgctgggcatacggaaagtactgagcccatatgacttgacccacaaggggaaatactggggcaagttctacatgcccaaacgtgtgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial ribosomal protein L28
- chromosome 12 open reading frame 5
- chromosome 9 open reading frame 78
- chromosome 1 open reading frame 63

Buy MRPL16-mitochondrial ribosomal protein L16 Gene now

Add to cart