Login to display prices
Login to display prices
MRPL16-mitochondrial ribosomal protein L16 Gene View larger

MRPL16-mitochondrial ribosomal protein L16 Gene

PTXBC001040

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPL16-mitochondrial ribosomal protein L16 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MRPL16-mitochondrial ribosomal protein L16 Gene

Proteogenix catalog: PTXBC001040
Ncbi symbol: MRPL16
Product name: MRPL16-mitochondrial ribosomal protein L16 Gene
Size: 2ug
Accessions: BC001040
Gene id: 54948
Gene description: mitochondrial ribosomal protein L16
Synonyms: L16mt; MRP-L16; PNAS-111; 39S ribosomal protein L16, mitochondrial; mitochondrial ribosomal protein L16
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggaggctgctggctcgcgctagtgcgccgctcctgcgggtgcccttgtcagattcctgggcactcctccccgccagtgctggcgtaaagacactgctcccagtaccaagttttgaagatgtttccattcctgaaaaacccaagcttagatttattgaaagggcaccacttgtgccaaaagtaagaagagaacctaaaaatttaagtgacatacggggaccttccactgaagctacggagtttacagaaggcaattttgcaatcttggcattgggtggtggctacctgcattggggccactttgaaatgatgcgcctgacaatcaaccgctctatggaccccaagaacatgtttgccatatggcgagtaccagcccctttcaagcccatcactcgcaaaagtgttgggcatcgcatggggggaggcaaaggtgctattgaccactacgtgacacctgtgaaggctggccgccttgttgtagagatgggtgggcgttgtgaatttgaagaagtgcaaggtttccttgaccaggttgcccacaagttgcccttcgcagcaaaggctgtgagccgcgggactctagagaagatgcgaaaagatcaagaggaaagagaacgtaacaaccagaacccctggacatttgagcgaatagccactgccaacatgctgggcatacggaaagtactgagcccatatgacttgacccacaaggggaaatactggggcaagttctacatgcccaaacgtgtgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: