Login to display prices
Login to display prices
MRPL28-mitochondrial ribosomal protein L28 Gene View larger

MRPL28-mitochondrial ribosomal protein L28 Gene

PTXBC000507

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPL28-mitochondrial ribosomal protein L28 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MRPL28-mitochondrial ribosomal protein L28 Gene

Proteogenix catalog: PTXBC000507
Ncbi symbol: MRPL28
Product name: MRPL28-mitochondrial ribosomal protein L28 Gene
Size: 2ug
Accessions: BC000507
Gene id: 10573
Gene description: mitochondrial ribosomal protein L28
Synonyms: MAAT1; p15; 39S ribosomal protein L28, mitochondrial; L28mt; MRP-L28; melanoma antigen p15; melanoma-associated antigen recognised by cytotoxic T lymphocytes; melanoma-associated antigen recognized by T-lymphocytes; mitochondrial ribosomal protein L28
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctctacacaagtatcccgtgtggctctggaagcggctgcagctgcgggagggcatctgttcccgcctgcccggccactacctgcgctccctggaggaggagcggacgcccactcccgtgcactataggcctcatggggccaagttcaagatcaaccccaagaacgggcagcgggagcgtgtggaggacgtgcccattcccatctactttccccccgaatcccagcgggggttgtggggcggcgagggctggatcctgggccaaatatatgccaacaacgacaagctctccaagaggctgaagaaagtgtggaagccacagctgtttgagcgagagttctacagtgagatcctggacaagaagttcacagtgactgtgaccatgcggaccctggacctcatcgatgaggcttacgggctcgacttttacatcctcaagaccccgaaggaggacctgtgctccaagtttgggatggacctgaagcgagggatgctgctgcggcttgcccggcaggacccccagctgcaccccgaggaccccgagcggcgggcagccatctacgacaagtacaaggaatttgccatcccagaggaggaggcagagtgggtgggcctcacgctggaggaggccattgagaagcagagacttttggaggagaaggaccctgtacccctgttcaagatctatgtggcggagctgatccagcagctgcagcagcaggcactgtcagagccggcggtggtgcagaagagagccagtggccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: