C12orf5-chromosome 12 open reading frame 5 Gene View larger

C12orf5-chromosome 12 open reading frame 5 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C12orf5-chromosome 12 open reading frame 5 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C12orf5-chromosome 12 open reading frame 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012340
Product type: DNA & cDNA
Ncbi symbol: C12orf5
Origin species: Human
Product name: C12orf5-chromosome 12 open reading frame 5 Gene
Size: 2ug
Accessions: BC012340
Gene id: 57103
Gene description: chromosome 12 open reading frame 5
Synonyms: C12orf5; FR2BP; fructose-2,6-bisphosphatase TIGAR; TP53-induced glycolysis and apoptosis regulator; fructose-2,6-bisphosphate 2-phosphatase; transactivated by NS3TP2 protein; TP53 induced glycolysis regulatory phosphatase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctcgcttcgctctgactgttgtccggcatggagaaacaagatttaacaaggagaaaataatccaaggacaaggagtagatgaacctctttcagaaactggatttaaacaagcagcagctgctggtatatttctgaataatgtgaagtttactcatgctttctccagtgatctcatgaggacaaagcagaccatgcatggaattttggagagaagcaaattttgcaaagatatgacggtaaagtatgactcaagacttcgggaaaggaaatacggggttgtagaaggcaaagcgctaagtgagctgagggccatggccaaagcagccagggaagagtgccctgtgtttacaccgcccggaggagagacgctggaccaggtgaaaatgcgtggaatagacttttttgaatttctttgtcaactaatcctgaaagaagcggatcaaaaagaacagttttcccaaggatctccaagcaactgtctggaaacttctttggcagagatatttcctttaggaaaaaatcacagctctaaagttaattcagacagcggtattccaggattagcagccagtgtcttagttgtgagtcacggtgcttacatgagaagtctgtttgattattttctgactgaccttaagtgttccttaccagccactctgagcagatctgaacttatgtcagtcactcccaatacagggatgagtctctttatcataaactttgaggaaggaagagaagttaaaccaacggttcagtgtatttgtatgaacctacaggatcatctaaatggactgactgaaactcgctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 9 open reading frame 78
- chromosome 1 open reading frame 63
- chromosome 8 open reading frame 38
- multiple C2 domains, transmembrane 2

Buy C12orf5-chromosome 12 open reading frame 5 Gene now

Add to cart