Login to display prices
Login to display prices
MRPS35-mitochondrial ribosomal protein S35 Gene View larger

MRPS35-mitochondrial ribosomal protein S35 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPS35-mitochondrial ribosomal protein S35 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MRPS35-mitochondrial ribosomal protein S35 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015862
Product type: DNA & cDNA
Ncbi symbol: MRPS35
Origin species: Human
Product name: MRPS35-mitochondrial ribosomal protein S35 Gene
Size: 2ug
Accessions: BC015862
Gene id: 60488
Gene description: mitochondrial ribosomal protein S35
Synonyms: HDCMD11P; MDS023; MRP-S28; MRPS28; 28S ribosomal protein S35, mitochondrial; 28S ribosomal protein S28, mitochondrial; MRP-S35; S28mt; S35mt; mitochondrial ribosomal protein S28; mitochondrial ribosomal protein S35
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaaaggagggaaatctagaacttttaaagattcccaattttctgcatttgactcctgtagcaattaaaaagcactgtgaagcccttaaagatttttgcactgagtggccagccgcactggacagtgacgagaaatgtgagaagcattttccaattgaaattgacagcactgattatgtttcatcaggaccatctgttcggaaccccagagcacgagtagtagtcttaagagtaaagctttccagtttgaatttagatgatcacgcaaagaagaaattaattaaacttgtaggagagcgatactgcaagaccacagatgtgcttaccatcaaaacagataggtgccctttaaggaggcagaattacgattatgcagtgtatctactaacagtgttataccatgagtcttggaatactgaagaatgggaaaaaagtaagactgaagcagacatggaagagtatatatgggaaaatagctcatcagaaagaaatatcctggaaacgcttctccagatgaaagctgctgagaaaaatatggaaataaataaagaagagctccttggtactaaagaaattgaagagtacaaaaagtctgttgttagtcttaaaaatgaggaggaaaatgaaaattccatttctcagtacaaagaatccgtgaagagactattaaatgtgacatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial ribosomal protein L16
- mitochondrial ribosomal protein L28
- chromosome 12 open reading frame 5
- chromosome 9 open reading frame 78