RAB6A-RAB6A, member RAS oncogene family Gene View larger

RAB6A-RAB6A, member RAS oncogene family Gene

PTXBC003617

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAB6A-RAB6A, member RAS oncogene family Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RAB6A-RAB6A, member RAS oncogene family Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003617
Product type: DNA & cDNA
Ncbi symbol: RAB6A
Origin species: Human
Product name: RAB6A-RAB6A, member RAS oncogene family Gene
Size: 2ug
Accessions: BC003617
Gene id: 5870
Gene description: RAB6A, member RAS oncogene family
Synonyms: RAB6A, member RAS oncogene family; RAB6; ras-related protein Rab-6A; RAB6, member RAS oncogene family; Rab GTPase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccacgggcggagacttcgggaatccgctgaggaaattcaagctggtgttcctgggggagcaaagcgttggaaagacatctttgatcaccagattcatgtatgacagttttgacaacacctatcaggcaacaattggcattgactttttatcaaaaactatgtacttggaggatcgaacaatcaggcttcagctgtgggatactgcgggtcaggaacgtttccgtagcctcattcccagttacatccgtgattctgctgcagctgtagtagtttacgatatcacaaatgttaactcattccagcaaactacaaagtggattgatgatgtcagaacagaaagaggaagtgatgttatcatcatgctagtaggaaataaaacagatcttgctgacaagaggcaagtgtcaattgaggagggagagaggaaagccaaagagctgaatgttatgtttattgaaactagtgcaaaagctggatacaatgtaaagcagctctttcgacgtgtagcagcagctttgccgggaatggaaagcacacaggacagaagcagagaagatatgattgacataaaactggaaaagcctcaggagcaaccagtcagtgaaggaggctgttcctgctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glutathione S-transferase alpha 4
- glutathione S-transferase kappa 1
- glutathione S-transferase omega 1
- Kv channel interacting protein 4

Buy RAB6A-RAB6A, member RAS oncogene family Gene now

Add to cart