Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of ACSM5-acyl-CoA synthetase medium-chain family member 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ACSM5-acyl-CoA synthetase medium-chain family member 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013753 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ACSM5 |
| Origin species: | Human |
| Product name: | ACSM5-acyl-CoA synthetase medium-chain family member 5 Gene |
| Size: | 2ug |
| Accessions: | BC013753 |
| Gene id: | 54988 |
| Gene description: | acyl-CoA synthetase medium-chain family member 5 |
| Synonyms: | acyl-coenzyme A synthetase ACSM5, mitochondrial; acyl-CoA synthetase medium-chain family member 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagaccatggctgagacacctagtcctccaggcactgaggaactccagggcattctgtgggtctcatgggaagccagcacctctacctgttcctcagaagatcgtggccacctgggaagccatcagcctgggaaggcagctggtgcctgagtacttcaacttcgcccatgatgtgctggatgtgtggagtcggctggaagaggctggacaccgccccccaaatcctgccttctggtgggtcaatggcacaggagcagagatcaagtggagctttgaggagctggggaagcagtccaggaaggcagccaatgtgctggggggtgcatgcggcctgcagcctggggacagaatgatgctggtactcccacggctcccggagtggtggctggtcagtgtggcttgcatgcggacagggactgtgatgattccgggtgtgactcagctgacagagaaggacctcaagtaccggctgcaggcgtccagggccaagtccattatcaccagtgactccctagctccaagggtggatgccatcagtgccgaatgcccctccctccagaccaagctgctggtgtcagacagcagtcggccaggctggttgaacttcagggaactcctccggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - small nuclear ribonucleoprotein polypeptide B'' - TCF3 (E2A) fusion partner (in childhood Leukemia) - peroxisome proliferator-activated receptor alpha - cell growth regulator with ring finger domain 1 |