ACSM5-acyl-CoA synthetase medium-chain family member 5 Gene View larger

ACSM5-acyl-CoA synthetase medium-chain family member 5 Gene

PTXBC013753

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACSM5-acyl-CoA synthetase medium-chain family member 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ACSM5-acyl-CoA synthetase medium-chain family member 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013753
Product type: DNA & cDNA
Ncbi symbol: ACSM5
Origin species: Human
Product name: ACSM5-acyl-CoA synthetase medium-chain family member 5 Gene
Size: 2ug
Accessions: BC013753
Gene id: 54988
Gene description: acyl-CoA synthetase medium-chain family member 5
Synonyms: acyl-coenzyme A synthetase ACSM5, mitochondrial; acyl-CoA synthetase medium-chain family member 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagaccatggctgagacacctagtcctccaggcactgaggaactccagggcattctgtgggtctcatgggaagccagcacctctacctgttcctcagaagatcgtggccacctgggaagccatcagcctgggaaggcagctggtgcctgagtacttcaacttcgcccatgatgtgctggatgtgtggagtcggctggaagaggctggacaccgccccccaaatcctgccttctggtgggtcaatggcacaggagcagagatcaagtggagctttgaggagctggggaagcagtccaggaaggcagccaatgtgctggggggtgcatgcggcctgcagcctggggacagaatgatgctggtactcccacggctcccggagtggtggctggtcagtgtggcttgcatgcggacagggactgtgatgattccgggtgtgactcagctgacagagaaggacctcaagtaccggctgcaggcgtccagggccaagtccattatcaccagtgactccctagctccaagggtggatgccatcagtgccgaatgcccctccctccagaccaagctgctggtgtcagacagcagtcggccaggctggttgaacttcagggaactcctccggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - small nuclear ribonucleoprotein polypeptide B''
- TCF3 (E2A) fusion partner (in childhood Leukemia)
- peroxisome proliferator-activated receptor alpha
- cell growth regulator with ring finger domain 1

Buy ACSM5-acyl-CoA synthetase medium-chain family member 5 Gene now

Add to cart