Login to display prices
Login to display prices
RGS4-regulator of G-protein signaling 4 Gene View larger

RGS4-regulator of G-protein signaling 4 Gene

PTXBC000737

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RGS4-regulator of G-protein signaling 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RGS4-regulator of G-protein signaling 4 Gene

Proteogenix catalog: PTXBC000737
Ncbi symbol: RGS4
Product name: RGS4-regulator of G-protein signaling 4 Gene
Size: 2ug
Accessions: BC000737
Gene id: 5999
Gene description: regulator of G-protein signaling 4
Synonyms: RGP4; SCZD9; regulator of G-protein signaling 4; schizophrenia disorder 9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgcaaagggcttgcaggtctgccggcttcttgcttgaggagtgcaaaagatatgaaacatcggctaggtttcctgctgcaaaaatctgattcctgtgaacacaattcttcccacaacaagaaggacaaagtggttatttgccagagagtgagccaagaggaagtcaagaaatgggctgaatcactggaaaacctgattagtcatgaatgtgggctggcagctttcaaagctttcttgaagtctgaatatagtgaggagaatattgacttctggatcagctgtgaagagtacaagaaaatcaaatcaccatctaaactaagtcccaaggccaaaaagatctataatgaattcatctcagtccaggcaaccaaagaggtgaacctggattcttgcaccagggaagagacaagccggaacatgctagagcctacaataacctgctttgatgaggcccagaagaagattttcaacctgatggagaaggattcctaccgccgcttcctcaagtctcgattctatcttgatttggtcaacccgtccagctgtggggcagaaaagcagaaaggagccaagagttcagcagactgtgcttccctggtccctcagtgtgcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: