Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RAB1A-RAB1A, member RAS oncogene family Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RAB1A-RAB1A, member RAS oncogene family Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000905 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RAB1A |
| Origin species: | Human |
| Product name: | RAB1A-RAB1A, member RAS oncogene family Gene |
| Size: | 2ug |
| Accessions: | BC000905 |
| Gene id: | 5861 |
| Gene description: | RAB1A, member RAS oncogene family |
| Synonyms: | RAB1A, member RAS oncogene family; GTP binding protein Rab1a; RAB1; YPT1; ras-related protein Rab-1A; RAB1, member RAS oncogene family; Rab GTPase YPT1 homolog; YPT1-related protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccagcatgaatcccgaatatgattatttattcaagttacttctgattggcgactcaggggttggaaagtcttgccttcttcttaggtttgcagatgatacatatacagaaagctacatcagcacaattggtgtggatttcaaaataagaactatagagttagacgggaaaacaatcaagcttcaaatatgggacacagcaggccaggaaagatttcgaacaatcacctccagttattacagaggagcccatggcatcatagttgtgtatgatgtgacagatcaggagtccttcaataatgttaaacagtggctgcaggaaatagatcgttatgccagtgaaaatgtcaacaaattgttggtagggaacaaatgtgatctgaccacaaagaaagtagtagactacacaacagcgaaggaatttgctgattcccttggaattccgtttttggaaaccagtgctaagaatgcaacgaatgtagaacagtctttcatgacgatggcagctgagattaaaaagcgaatgggtcccggagcaacagctggtggtgctgagaagtccaatgttaaaattcagagcactccagtcaagcagtcaggtggaggttgctgctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - regulator of G-protein signaling 4 - RAB6A, member RAS oncogene family - glutathione S-transferase alpha 4 - glutathione S-transferase kappa 1 |