RAB1A-RAB1A, member RAS oncogene family Gene View larger

RAB1A-RAB1A, member RAS oncogene family Gene

PTXBC000905

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAB1A-RAB1A, member RAS oncogene family Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RAB1A-RAB1A, member RAS oncogene family Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000905
Product type: DNA & cDNA
Ncbi symbol: RAB1A
Origin species: Human
Product name: RAB1A-RAB1A, member RAS oncogene family Gene
Size: 2ug
Accessions: BC000905
Gene id: 5861
Gene description: RAB1A, member RAS oncogene family
Synonyms: RAB1A, member RAS oncogene family; GTP binding protein Rab1a; RAB1; YPT1; ras-related protein Rab-1A; RAB1, member RAS oncogene family; Rab GTPase YPT1 homolog; YPT1-related protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccagcatgaatcccgaatatgattatttattcaagttacttctgattggcgactcaggggttggaaagtcttgccttcttcttaggtttgcagatgatacatatacagaaagctacatcagcacaattggtgtggatttcaaaataagaactatagagttagacgggaaaacaatcaagcttcaaatatgggacacagcaggccaggaaagatttcgaacaatcacctccagttattacagaggagcccatggcatcatagttgtgtatgatgtgacagatcaggagtccttcaataatgttaaacagtggctgcaggaaatagatcgttatgccagtgaaaatgtcaacaaattgttggtagggaacaaatgtgatctgaccacaaagaaagtagtagactacacaacagcgaaggaatttgctgattcccttggaattccgtttttggaaaccagtgctaagaatgcaacgaatgtagaacagtctttcatgacgatggcagctgagattaaaaagcgaatgggtcccggagcaacagctggtggtgctgagaagtccaatgttaaaattcagagcactccagtcaagcagtcaggtggaggttgctgctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - regulator of G-protein signaling 4
- RAB6A, member RAS oncogene family
- glutathione S-transferase alpha 4
- glutathione S-transferase kappa 1

Buy RAB1A-RAB1A, member RAS oncogene family Gene now

Add to cart