CCDC69-coiled-coil domain containing 69 Gene View larger

CCDC69-coiled-coil domain containing 69 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCDC69-coiled-coil domain containing 69 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CCDC69-coiled-coil domain containing 69 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016647
Product type: DNA & cDNA
Ncbi symbol: CCDC69
Origin species: Human
Product name: CCDC69-coiled-coil domain containing 69 Gene
Size: 2ug
Accessions: BC016647
Gene id: 26112
Gene description: coiled-coil domain containing 69
Synonyms: coiled-coil domain-containing protein 69; coiled-coil domain containing 69
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggacctccatgtccgaagccgcaaccaggtggtcctgtcaaggcagctgtcagaagacctgcttctcacgcgtgaggccctggagaaggaggtgcagctgcggcgacagctccagcaggagaaggaggagctgttgtaccggatccttggggccaatgcctcgcctgccttccctctggcccctgtcactcccactgaggtctctttcctcgccacatagggtgcagggcctgggcccaccacgacgcctgaagtcacagctccttccaaggtttttctggagaagacagcaggagcctctcagttcttttccaggaaggaacgagggtgggagcgagatggagatcctgggtgtgtgcccagtgagccctggggccttgagttacatggaatcacccacagggttttggaggccccgagaagcgtcttcccttgagttggccaagggaataagcaagaggagacatttcctccctgccccagcactctgtcccaatccgagaagttccgaggctttcccggggcagtctgtgtcacgctggccatttgacataaaggagacagcccctggtcccagcttgtcagctctgctgccgacttgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RAB1A, member RAS oncogene family
- regulator of G-protein signaling 4
- RAB6A, member RAS oncogene family
- glutathione S-transferase alpha 4

Buy CCDC69-coiled-coil domain containing 69 Gene now

Add to cart