Login to display prices
Login to display prices
CCDC69-coiled-coil domain containing 69 Gene View larger

CCDC69-coiled-coil domain containing 69 Gene

PTXBC016647

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCDC69-coiled-coil domain containing 69 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CCDC69-coiled-coil domain containing 69 Gene

Proteogenix catalog: PTXBC016647
Ncbi symbol: CCDC69
Product name: CCDC69-coiled-coil domain containing 69 Gene
Size: 2ug
Accessions: BC016647
Gene id: 26112
Gene description: coiled-coil domain containing 69
Synonyms: coiled-coil domain-containing protein 69; coiled-coil domain containing 69
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggacctccatgtccgaagccgcaaccaggtggtcctgtcaaggcagctgtcagaagacctgcttctcacgcgtgaggccctggagaaggaggtgcagctgcggcgacagctccagcaggagaaggaggagctgttgtaccggatccttggggccaatgcctcgcctgccttccctctggcccctgtcactcccactgaggtctctttcctcgccacatagggtgcagggcctgggcccaccacgacgcctgaagtcacagctccttccaaggtttttctggagaagacagcaggagcctctcagttcttttccaggaaggaacgagggtgggagcgagatggagatcctgggtgtgtgcccagtgagccctggggccttgagttacatggaatcacccacagggttttggaggccccgagaagcgtcttcccttgagttggccaagggaataagcaagaggagacatttcctccctgccccagcactctgtcccaatccgagaagttccgaggctttcccggggcagtctgtgtcacgctggccatttgacataaaggagacagcccctggtcccagcttgtcagctctgctgccgacttgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: