DNAJC12-DnaJ (Hsp40) homolog, subfamily C, member 12 Gene View larger

DNAJC12-DnaJ (Hsp40) homolog, subfamily C, member 12 Gene

PTXBC017018

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DNAJC12-DnaJ (Hsp40) homolog, subfamily C, member 12 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DNAJC12-DnaJ (Hsp40) homolog, subfamily C, member 12 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017018
Product type: DNA & cDNA
Ncbi symbol: DNAJC12
Origin species: Human
Product name: DNAJC12-DnaJ (Hsp40) homolog, subfamily C, member 12 Gene
Size: 2ug
Accessions: BC017018
Gene id: 56521
Gene description: DnaJ (Hsp40) homolog, subfamily C, member 12
Synonyms: dnaJ homolog subfamily C member 12; DnaJ (Hsp40) homolog, subfamily C, member 12; J domain containing protein 1 (JDP1); J domain protein 1; j domain-containing protein 1; DnaJ heat shock protein family (Hsp40) member C12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatgcaatactgaattacaggtcagaagatactgaagattactacacattactgggatgtgatgaactatcttcggttgaacaaatcctggcagaatttaaagtcagagctctggaatgtcacccagacaagcatcctgaaaaccccaaagctgtggagacttttcagaaactgcagaaggcaaaggagattctgaccaatgaagagagtcgagcccgctatgaccactggcgaaggagccagatgtcgatgccattccagcagtgggaagctttgaatgactcagtgaagacgtcaatgcactgggttgtcagaggtaaaaaagacctgatgctggaagaatctgacaagactcataccaccaagatggaaaatgaggaatgtaatgagcaaagagaaagaaagaaagaggagctggcttcaaccgcagagaaaacggagcagaaagaacccaagcccctagagaagtcagtctccccgcaaaattcagattcttcaggttttgcagatgtgaatggttggcaccttcgtttccgctggtccaaggatgctccctcagaactcctgaggaagttcagaaactatgaaatatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DiGeorge syndrome critical region gene 6-like
- splicing factor, arginine/serine-rich 7, 35kDa
- nicotinamide nucleotide adenylyltransferase 1
- DnaJ (Hsp40) homolog, subfamily C, member 28

Buy DNAJC12-DnaJ (Hsp40) homolog, subfamily C, member 12 Gene now

Add to cart