Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of DGCR6L-DiGeorge syndrome critical region gene 6-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DGCR6L-DiGeorge syndrome critical region gene 6-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000682 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DGCR6L |
| Origin species: | Human |
| Product name: | DGCR6L-DiGeorge syndrome critical region gene 6-like Gene |
| Size: | 2ug |
| Accessions: | BC000682 |
| Gene id: | 85359 |
| Gene description: | DiGeorge syndrome critical region gene 6-like |
| Synonyms: | protein DGCR6L; DGCR6; diGeorge syndrome critical region 6-like protein; DiGeorge syndrome critical region gene 6-like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagcgctacgcggccgccttggaggaggtggcggacggtgcccggcagcaggagcgacactaccagttgctgtcggcgctacagagcctggtgaaggagttgcccagctctttccagcagcgcctgtcctacaccacgctcagcgacctggccctggcgcttctcgacggcaccgtgttcgaaatcgtgcaggggctactggagatccagcacctcaccgaaaagagcctgtacaaccagcgcctgcgcctacagaacgagcaccgagtgctcaggcaggcgctgcggcagaagcaccaggaagcccagcaggcctgccggccccacaacctgcctgtggttcaggcggctcagcagcgagaactagaggccgtggaacaccggatccgtgaggagcagcgggcgatggaccagaagatcatcctggagctggaccggaaggtggctgaccagcagagcacactggagaaggcgggggtggctggcttctacgtgaccaccaacccacaggagctgatgctgcagatgaacctgctggaactcatccgaaagctgcagcagaggggctgccgggcagggaatgcagccctgggactgggaggtccctggcagtcgcctgctgcccagtgtgaccagaaaggcagccctgtcccaccatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - splicing factor, arginine/serine-rich 7, 35kDa - nicotinamide nucleotide adenylyltransferase 1 - DnaJ (Hsp40) homolog, subfamily C, member 28 - growth hormone inducible transmembrane protein |