Login to display prices
Login to display prices
SFRS7-splicing factor, arginine/serine-rich 7, 35kDa Gene View larger

SFRS7-splicing factor, arginine/serine-rich 7, 35kDa Gene

PTXBC000997

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SFRS7-splicing factor, arginine/serine-rich 7, 35kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SFRS7-splicing factor, arginine/serine-rich 7, 35kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000997
Product type: DNA & cDNA
Ncbi symbol: SFRS7
Origin species: Human
Product name: SFRS7-splicing factor, arginine/serine-rich 7, 35kDa Gene
Size: 2ug
Accessions: BC000997
Gene id: 6432
Gene description: splicing factor, arginine/serine-rich 7, 35kDa
Synonyms: SFRS7; 9G8; AAG3; serine/arginine-rich splicing factor 7; SR splicing factor 7; aging-associated protein 3; splicing factor 9G8; splicing factor, arginine/serine-rich 7, 35kDa; serine and arginine rich splicing factor 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgcgttacgggcggtacggaggagaaaccaaggtgtatgttggtaacctgggaactggcgctggcaaaggagagttagaaagggctttcagttattatggtcctttaagaactgtatggattgcgagaaatcctccaggatttgcctttgtggaattcgaagatcctagagatgcagaagatgcagtacgaggactggatggaaaggtgatttgtggctcccgagtgagggttgaactatcgacaggcatgcctcggagatcacgttttgatagaccacctgcccgacgtccctttgatccaaatgatagatgctatgagtgtggcgaaaagggacattatgcttatgattgtcatcgttacagccggcgaagaagaagcaggtcacggtctagatcacattctcgatccagaggaaggcgatactctcgctcacgcagcaggagcaggggacgaaggtcaaggtcagcatctcctcgacgatcaagatctatctctcttcgtagatcaagatcagcttcactcagaagatctaggtctggttctataaaaggatcgaggtatttccaatccccgtcgaggtcaagatcaagatccaggtctatttcacgaccaagaagcagccgatcaaagtccagatctccatctccaaaaagaagtcgttccccatcaggaagtcctcgcagaagtgcaagtcctgaaagaatggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nicotinamide nucleotide adenylyltransferase 1
- DnaJ (Hsp40) homolog, subfamily C, member 28
- growth hormone inducible transmembrane protein
- DnaJ (Hsp40) homolog, subfamily B, member 11