Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of DNAJB11-DnaJ (Hsp40) homolog, subfamily B, member 11 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DNAJB11-DnaJ (Hsp40) homolog, subfamily B, member 11 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001144 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DNAJB11 |
| Origin species: | Human |
| Product name: | DNAJB11-DnaJ (Hsp40) homolog, subfamily B, member 11 Gene |
| Size: | 2ug |
| Accessions: | BC001144 |
| Gene id: | 51726 |
| Gene description: | DnaJ (Hsp40) homolog, subfamily B, member 11 |
| Synonyms: | ABBP-2; ABBP2; DJ9; Dj-9; EDJ; ERdj3; ERj3; ERj3p; PRO1080; UNQ537; dnaJ homolog subfamily B member 11; APOBEC1-binding protein 2; DnaJ (Hsp40) homolog, subfamily B, member 11; DnaJ protein 9; ER-associated DNAJ protein 3; ER-associated Hsp40 co-chaperone; ER-resident protein ERdj3; PWP1-interacting protein 4; endoplasmic reticulum DNA J domain-containing protein 3; DnaJ heat shock protein family (Hsp40) member B11 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctccgcagaacctgagcaccttttgcctgttgctgctatacctcatcggggcggtgattgccggacgagatttctataagatcttgggggtgcctcgaagtgcctctataaaggatattaaaaaggcctataggaaactagccctgcagcttcatcccgaccggaaccctgatgatccacaagcccaggagaaattccaggatctgggtgctgcttatgaggttctgtcagatagtgagaaacggaaacagtacgatacttatggtgaagaaggattaaaagatggtcatcagagctcccatggagacattttttcacacttctttggggattttggtttcatgtttggaggaacccctcgtcagcaagacagaaatattccaagaggaagtgatattattgtagatctagaagtcactttggaagaagtatatgcaggaaattttgtggaagtagttagaaacaaacctgtggcaaggcaggctcctggcaaacggaagtgcaattgtcggcaagagatgcggaccacccagctgggccctgggcgcttccaaatgacccaggaggtggtctgcgacgaatgccctaatgtcaaactagtgaatgaagaacgaacgctggaagtagaaatagagcctggggtgagagacggcatggagtacccctttattggagaaggtgagcctcacgtggatggggagcctggagatttacggttccgaatcaaagttgtcaagcacccaatatttgaaaggagaggagatgatttgtacacaaatgtgacaatctcattagttgagtcactggttggctttgagatggatattactcacttggatggtcacaaggtacatatttcccgggataagatcaccaggccaggagcgaagctatggaagaaaggggaagggctccccaactttgacaacaacaatatcaagggctctttgataatcacttttgatgtggattttccaaaagaacagttaacagaggaagcgagagaaggtatcaaacagctactgaaacaagggtcagtgcagaaggtatacaatggactgcaaggatattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - developmentally regulated GTP binding protein 2 - phosphate cytidylyltransferase 2, ethanolamine - SH3-domain binding protein 5 (BTK-associated) - cell division cycle 20 homolog (S. cerevisiae) |