DNAJB11-DnaJ (Hsp40) homolog, subfamily B, member 11 Gene View larger

DNAJB11-DnaJ (Hsp40) homolog, subfamily B, member 11 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DNAJB11-DnaJ (Hsp40) homolog, subfamily B, member 11 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DNAJB11-DnaJ (Hsp40) homolog, subfamily B, member 11 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001144
Product type: DNA & cDNA
Ncbi symbol: DNAJB11
Origin species: Human
Product name: DNAJB11-DnaJ (Hsp40) homolog, subfamily B, member 11 Gene
Size: 2ug
Accessions: BC001144
Gene id: 51726
Gene description: DnaJ (Hsp40) homolog, subfamily B, member 11
Synonyms: ABBP-2; ABBP2; DJ9; Dj-9; EDJ; ERdj3; ERj3; ERj3p; PRO1080; UNQ537; dnaJ homolog subfamily B member 11; APOBEC1-binding protein 2; DnaJ (Hsp40) homolog, subfamily B, member 11; DnaJ protein 9; ER-associated DNAJ protein 3; ER-associated Hsp40 co-chaperone; ER-resident protein ERdj3; PWP1-interacting protein 4; endoplasmic reticulum DNA J domain-containing protein 3; DnaJ heat shock protein family (Hsp40) member B11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctccgcagaacctgagcaccttttgcctgttgctgctatacctcatcggggcggtgattgccggacgagatttctataagatcttgggggtgcctcgaagtgcctctataaaggatattaaaaaggcctataggaaactagccctgcagcttcatcccgaccggaaccctgatgatccacaagcccaggagaaattccaggatctgggtgctgcttatgaggttctgtcagatagtgagaaacggaaacagtacgatacttatggtgaagaaggattaaaagatggtcatcagagctcccatggagacattttttcacacttctttggggattttggtttcatgtttggaggaacccctcgtcagcaagacagaaatattccaagaggaagtgatattattgtagatctagaagtcactttggaagaagtatatgcaggaaattttgtggaagtagttagaaacaaacctgtggcaaggcaggctcctggcaaacggaagtgcaattgtcggcaagagatgcggaccacccagctgggccctgggcgcttccaaatgacccaggaggtggtctgcgacgaatgccctaatgtcaaactagtgaatgaagaacgaacgctggaagtagaaatagagcctggggtgagagacggcatggagtacccctttattggagaaggtgagcctcacgtggatggggagcctggagatttacggttccgaatcaaagttgtcaagcacccaatatttgaaaggagaggagatgatttgtacacaaatgtgacaatctcattagttgagtcactggttggctttgagatggatattactcacttggatggtcacaaggtacatatttcccgggataagatcaccaggccaggagcgaagctatggaagaaaggggaagggctccccaactttgacaacaacaatatcaagggctctttgataatcacttttgatgtggattttccaaaagaacagttaacagaggaagcgagagaaggtatcaaacagctactgaaacaagggtcagtgcagaaggtatacaatggactgcaaggatattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - developmentally regulated GTP binding protein 2
- phosphate cytidylyltransferase 2, ethanolamine
- SH3-domain binding protein 5 (BTK-associated)
- cell division cycle 20 homolog (S. cerevisiae)

Buy DNAJB11-DnaJ (Hsp40) homolog, subfamily B, member 11 Gene now

Add to cart